Occurrence record: BOLD - Australian records - 3751461

GenomicDNA of LEPIDOPTERA | Moths recorded on 1998-09-07

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3751461
Other catalogue numbers recordID:1650215;ProcessID:ANICI531-10;sampleID:10ANIC-05528
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Edwards, E.D.|Sutrisno, H.
Supplied as "E.D.Edwards, H.Sutrisno"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 1998-09-07
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Queensland
Local government area Isaac (R)
Locality Broken River
Latitude -21.1
Longitude 148.3
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HQ948962
markercode COI-5P
nucleotides AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCTTTGAGTTTATTAATTCGAGCAGAATTAGGAAATCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACAATTGTTACAGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGTGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCACCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTCTGACTTCTTCCCCCTTCTTTAACTCTTCTTATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCACGGAGGTAGATCAGTAGATTTAGCTATTTTTTCACTTCACTTAGCTGGTATTTCTTCAATTTTAGGAGCCATTAATTTTATTTCAACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCAGTTGGTATTACAGCTTTTTTACTTCTTCTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCAGGTGGGGGAGACCCAATTCTATATCAACATTTATTT
owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:43Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Tropical Savanna Australian Tropical Savanna
    Fallow practice - dominant (area) Fallow less than 3 months
    Fallow practice - dominant (number) Fallow less than 3 months
    GER National Corridor GER National Corridor
    GER Standard Boundary GER Standard Boundary
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Marine Great Barrier Reef
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    Irrigation practice - dominant 6. Local knowledge
    Land use Grazing of native pastures
    NRM Regions 2010 Burdekin
    NRM Regions 2014 Burdekin
    NRM Regions 2015 Burdekin
    NRM Regions 2017 Burdekin
    NRM Regions 2017 (Qld 2019) Burdekin
    Stubble practice - dominant (area) Stubble ploughed in
    Stubble practice - dominant (number) Ploughed = mulched
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 Burdekin
    Biodiversity
    Freshwater Ecoregions of the World Eastern Coastal Australia
    IBRA 6 Regions Brigalow Belt North
    IBRA 6 Sub Regions Bogie River Hills
    IBRA 7 Regions Brigalow Belt North
    IBRA 7 Subregions Bogie River Hills
    Terrestrial Ecoregional Boundaries Brigalow Tropical Savanna
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Strongly developed wet and dry seasons with cooler winter and with a growing season lasting at least six months
    Koppen Climate Classification (All Classes) Subtropical: moderately dry winter
    Koppen Climate Classification (Major Classes) Subtropical
    Fire
    Fire regime niches Eucalypt forest and woodland (tropical)
    Hydrology
    Drainage Divisions Level 1 North East Coast
    Drainage Divisions Level 2 BURDEKIN RIVER
    River Regions BURDEKIN RIVER
    Marine
    Marine Ecoregions of the World Central and Southern Great Barrier Reef
    States including coastal waters Queensland (including Coastal Waters)
    Political
    ASGS Australian States and Territories Queensland
    Australian States and Territories Queensland
    Commonwealth Electoral Boundaries Capricornia
    Indigenous Land Use Agreements QGC and Wiri ILUA
    Local Government Areas 2011 Isaac (R)
    Local Government Areas 2012 deprecated Nebo
    Local Government Areas PSMA 2018 ISAAC REGIONAL
    Native Title Determinations (13/7/2020) Widi People of the Nebo Estate #1 QCD2019/004
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 4
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 744
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF QLD
    PSMA ABS SA2 Statistical Areas (2016) BROADSOUND - NEBO
    PSMA ABS SA3 Statistical Areas (2016) BOWEN BASIN - NORTH
    PSMA ABS SA4 Statistical Areas (2016) MACKAY - ISAAC - WHITSUNDAY
    PSMA Commonwealth Electoral Boundaries (2016) CAPRICORNIA
    PSMA Commonwealth Electoral Boundaries (2018) CAPRICORNIA
    PSMA Indigenous Areas (2016) NEBO - CLERMONT
    PSMA Indigenous Locations (2016) NEBO - CLERMONT
    PSMA Indigenous Regions (2016) ROCKHAMPTON
    PSMA Localities (2018) TURRAWULLA
    PSMA Remoteness Areas (2016) Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (QLD)
    PSMA State Electoral Boundaries (2016) MIRANI
    PSMA State Electoral Boundaries (2018) BURDEKIN
    PSMA States (2016) QUEENSLAND
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (QLD)
    Statistical Local Areas Isaac (R) - Nebo
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Bowen Region
    Surface Geology of Australia Pwlz
    Topography
    Physiographic Provinces of Australia Fitzroy Uplands Province
    Physiographic Regions 2011 Connors Ranges
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Native forest
    Forests of Australia (2013) v2.0 Eucalypt Medium Woodland
    Land cover Native shrublands and heathlands
    NVIS 4.1 Major Vegetation Groups Rainforests and Vine Thickets
    NVIS 4.1 Major Vegetation Subgroups Dry rainforest or vine thickets
    Tenure of Australia's forests (2013) v2.0 Leasehold
    Vegetation - condition Modified
    Vegetation types - native Eucalypt woodlands
    Vegetation types - present Eucalyptus woodlands

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 4273293.0 $
    Area management
    Phosphorus 0.026713487 t/ha
    Potassium 0.089424215 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.4629
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.4552
    Endemism 0.011681989
    Endemism (Non-marine) 0.011734942
    Mammals – Fritz et al 2009 - 0.5 degree 0.3689
    Migratory species (2008) 5.0 frequency
    Occurrence Density 203.0 frequency
    Shannon Diversity (H) 2.604079 index
    Species Richness 73.0 frequency
    Threatened communities (2008) 1.0 frequency
    Threatened species (2008) 7.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.48684192
    2030A1BMk35M: Evaporation - month min 99.92 mm
    2030A1BMk35M: Precipitation - annual mean 87.45416 mm
    2030A1BMk35M: Precipitation - driest month 15.69 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.42853037
    2030A1BMk35M: Precipitation - spring or autumn season -1.3224763
    2030A1BMk35M: Temperature - annual max mean 27.615833 degrees C
    2030A1BMk35M: Temperature - annual min mean 16.45 degrees C
    2030A1BMk35M: Temperature - annual range 22.309998 degrees C
    Aridity index - annual mean 0.634905
    Aridity index - month max 1.4835134
    Aridity index - month min 0.15279034
    Evaporation - annual mean 144.31349 (ml/5km x 5km pixel)
    Evaporation - average 15739.0 ml
    Evaporation - month max 204.23402 mm
    Evaporation - month min 79.072426 mm
    Evaporation - variability 21.0 %
    Growth index C3 macrotherm plants - annual mean 0.36 index
    Growth index C3 mesotherm plants - annual mean 0.52 index
    Growth index C4 megatherm plants - annual mean 0.28 index
    Humidity - annual mean relative 78.97409 %
    Humidity - annual mean relative 3pm 66.308685 %
    Humidity - month max relative 84.99815 %
    Humidity - month max relative 3pm 70.90582 %
    Humidity - month min relative 60.104023 %
    Humidity - month min relative 3pm 60.104023 %
    Precipitation - annual 1134.0 mm
    Precipitation - annual (Bio12) 1125.0 mm
    Precipitation - annual mean 91.63876 mm
    Precipitation - annual seasonality 1.767317
    Precipitation - coldest quarter (Bio19) 127.0 mm
    Precipitation - driest month 22.753796 mm
    Precipitation - driest period (Bio14) 3.0 mm
    Precipitation - driest quarter (Bio17) 91.0 mm
    Precipitation - equinox seasonality ratio 0.41299507
    Precipitation - seasonality (Bio15) 69.0 mm
    Precipitation - spring or autumn season -1.4103407
    Precipitation - warmest quarter (Bio18) 532.0 mm
    Precipitation - wettest month 223.41278 mm
    Precipitation - wettest period (Bio13) 60.0 mm
    Precipitation - wettest quarter (Bio16) 563.0 mm
    Radiation - annual mean (Bio20) 19.1 MJ/m2/day
    Radiation - seasonality (Bio23) 19.0
    Radiation - warmest quarter (Bio26) 22.0 MJ/m2/day
    Temperature - annual max mean 26.096666 degrees C
    Temperature - annual mean (Bio01) 21.1 degrees C
    Temperature - annual min mean 14.573333 degrees C
    Temperature - annual range 21.236938 degrees C
    Temperature - annual range (Bio07) 22.4 degrees C
    Temperature - coldest month min 8.15 degrees C
    Temperature - coldest period min (Bio06) 8.7 degrees C
    Temperature - coldest quarter mean (Bio11) 15.6 degrees C
    Temperature - diurnal range mean (Bio02) 11.1 degrees C
    Temperature - driest quarter mean (Bio09) 17.4 degrees C
    Temperature - isothermality (Bio03) 0.49 %
    Temperature - month hottest maximum 30.37 degrees C
    Temperature - seasonality (Bio04) 1.32
    Temperature - warmest month min 19.63 degrees C
    Temperature - warmest period max (Bio05) 31.2 degrees C
    Temperature - warmest quarter (Bio10) 25.3 degrees C
    Temperature - wettest quarter mean (Bio08) 25.2 degrees C
    Wind run - annual mean 132.16325 km/day
    WorldClim: Precipitation - annual 949.0 mm
    WorldClim: Precipitation - coldest quarter 78.0 mm
    WorldClim: Precipitation - driest month 15.0 mm
    WorldClim: Precipitation - driest quarter 64.0 mm
    WorldClim: Precipitation - seasonality 73.0
    WorldClim: Precipitation - warmest quarter 481.0 mm
    WorldClim: Precipitation - wettest month 186.0 mm
    WorldClim: Precipitation - wettest quarter 495.0 mm
    WorldClim: Temperature - annual mean 205.0 degrees C * 10
    WorldClim: Temperature - annual range 227.0 degrees C * 10
    WorldClim: Temperature - coldest month min 78.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 151.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 118.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 163.0 degrees C * 10
    WorldClim: Temperature - isothermality 51.0 %
    WorldClim: Temperature - seasonality 3755.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 305.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 246.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 242.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.5860034 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.089442715 km
    Euclidean Distance to Coast (metres) 74647.46 m
    Remoteness index 7.010897
    Hydrology
    Drainage - average 254.0 megalitres/5x5km/year
    Drainage - variability 178.0 %
    Runoff - average 3953.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Marine
    Great Barrier Reef 100m DEM 531.8 m
    Social
    Population - density SLA 2006 p/sqkm) 0.19106112 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 81.0
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 53.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.56 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 35.0 %
    Bulk density 1.6082813 Mg/m^3
    Carbon - organic 0.5781048 %
    Clay % 40.67383 %
    Hydrologic conductivity - average saturated 47.5 mm/h
    Moisture Index - annual mean (Bio28) 0.68
    Moisture Index - highest quarter mean (Bio32) 0.99
    Nutrient status 1.9 index
    Ph - soil 5.0 ph
    Soil depth 0.8 m
    Soil pedality 3.650651
    Water holding capacity 26000.0 mm
    Water stress index - month max 81.0
    Weathering Intensity V2 2.27288 Weathering Intensity Index
    Topography
    Aspect 240.0 degrees
    Averaged Topographic Relief 337.125 metres
    Bathymetry and Elvation 9 sec 457.0 m
    Elevation 587.0 m
    Topographic Slope (degrees) 6.4043984 degrees
    Topographic relief 159.0863 m
    Topographic slope (%) 8.560656 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3471 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 46.0 %
    Gross Primary Productivity (2012-03-13) 0.0125 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 1.0 m^2 plant / m^2 ground
    NDVI Mean 54.0 NDVI x 100
    NPP Mean 7.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.8425 NDVI