Occurrence record:

EnvironmentalDNA of Clathrus ruber recorded on 2012-09-24

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2012-09-24
Date precision Day

Taxonomy

Scientific name Clathrus ruber
Taxon rank species
Kingdom Fungi
Phylum Basidiomycota
Class Agaricomycetes
Order Phallales
Family Phallaceae
Genus Clathrus
Species Clathrus ruber
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Australian Capital Territory
Local government area Unincorp. Other Territories
Locality Booderee
Latitude -35.1512279949999
Longitude 150.648699421
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial
Verbatim elevation 22.0

Additional properties

ammonium nitrogen mg kg 3.0
amplicon ITS1FITS4_fungi
australian soil classification Rudosols
boron hot cacl2 mg kg 0.32
broad land use Conservation and Natural Environments
clay 7.97
color LTGR
conductivity dsm ds m 0.034
course sand 78.27
depth m 20.0
detailed land use Conservation and Natural Environments - Nature conservation - National park
dtpa copper mg kg 0.37
dtpa iron mg kg 65.01
dtpa manganese mg kg 3.46
dtpa zinc mg kg 0.36
environment Soil
exc aluminium meq 100g 0.036
exc calcium meq 100g 3.56
exc magnesium meq 100g 0.82
exc potassium meq 100g 0.12
exc sodium meq 100g 0.15
fine sand 9.73
general ecological zone Temperate
gravel 0.0
nitrate nitrogen mg kg 1e-10
otu CTGAATTTATTTTCAAATCCCTTTCACACACCTGTGCACTCTAGCGCGAGGGGAGACCCTCCGCGTTTTTACAATACACCCTACGCCTGTCGTACGCATGCGATAAATAAAAAAAGTTTATATATAAAAACA
otucount 1
organic carbon 1.5
ph level cacl2 cacl2 4.6
ph level h2o h2o 5.6
phosphorus colwell mg kg 1e-10
potassium colwell mg kg 45.0
sample id 102.100.100/7844
sample type Soil
sand 88.0
silt 4.03
slope 0.5
soil moisture 14.41
sulphur mg kg 2.5
texture 1.5
vegetation type Forest
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Altitude out of range Passed
    Altitude value non-numeric Passed
    Altitude value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Habitat incorrect for species Passed
    Show/Hide 12 missing properties
    Show/Hide 44 tests that have not been run

    Additional political boundaries information

    Area Management
    CAPAD 2010 Terrestrial Booderee
    CAPAD 2012 Terrestrial Booderee
    CAPAD 2014 Terrestrial Booderee
    CAPAD 2016 Terrestrial Booderee
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    GER Illawarra to Shoalhaven GER Illawarra to Shoalhaven
    GER National Corridor GER National Corridor
    GER Standard Boundary GER Standard Boundary
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    Important Bird Areas (IBA) Australia Jervis Bay IBA
    Irrigation practice - dominant No irrigation
    NRM Regions 2010 Southern Rivers
    NRM Regions 2014 South East NSW
    NRM Regions 2015 South East NSW
    NRM Regions 2017 South East NSW
    NRM Regions 2017 (Qld 2019) South East NSW
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 South East NSW
    Biodiversity
    Freshwater Ecoregions of the World Eastern Coastal Australia
    IBRA 6 Regions Sydney Basin
    IBRA 6 Sub Regions Jervis
    IBRA 7 Regions Sydney Basin
    IBRA 7 Subregions Jervis
    Terrestrial Ecoregional Boundaries Eastern Australian Temperate Forests
    World Anthropogenic Biomes (2000) Urban
    Climate
    Agroclimatic classification of Australia Cooler end of the warm, wet sub-tropical climates��
    Fire
    Fire regime niches Pasture, cropland (temperate)
    Hydrology
    Drainage Divisions Level 1 South East Coast (NSW)
    Drainage Divisions Level 2 CLYDE RIVER-JERVIS BAY
    River Regions CLYDE RIVER-JERVIS BAY
    Marine
    Marine Ecoregions of the World Cape Howe
    States including coastal waters Jervis Bay Territory
    Political
    ASGS Australian States and Territories Other Territories
    Australian States and Territories Australian Capital Territory
    Commonwealth Electoral Boundaries Fraser
    Local Government Areas 2011 Unincorp. Other Territories
    Local Government Areas 2012 deprecated Jervis Bay
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 38
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 207
    PSMA ABS Greater Capital City Statistical Areas (2016) OTHER TERRITORIES
    PSMA ABS SA2 Statistical Areas (2016) JERVIS BAY
    PSMA ABS SA3 Statistical Areas (2016) JERVIS BAY
    PSMA ABS SA4 Statistical Areas (2016) OTHER TERRITORIES
    PSMA Commonwealth Electoral Boundaries (2016) FENNER
    PSMA Commonwealth Electoral Boundaries (2018) FENNER
    PSMA Indigenous Areas (2016) JERVIS BAY
    PSMA Indigenous Locations (2016) JERVIS BAY EXC. WRECK BAY
    PSMA Indigenous Regions (2016) JERVIS BAY
    PSMA Localities (2018) JERVIS BAY
    PSMA Remoteness Areas (2016) Inner Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (OT)
    PSMA States (2016) OTHER TERRITORIES
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (OT)
    Statistical Local Areas Jervis Bay Territory
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Sydney Region
    Surface Geology of Australia Qa
    Topography
    Physiographic Provinces of Australia Kosciuszkan Uplands Province
    Physiographic Regions 2011 Monaro Fall
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Indigenous managed, Native forest
    Forests of Australia (2013) v2.0 Eucalypt Medium Open
    NVIS 4.1 Major Vegetation Groups Eucalypt Open Forests
    NVIS 4.1 Major Vegetation Subgroups Eucalyptus tall open forests and open forests with ferns, herbs, sedges, rushes or wet tussock grasses
    Tenure of Australia's forests (2013) v2.0 Private Freehold

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.9825
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 4.0322
    Endemism 0.013896161
    Endemism (Non-marine) 0.016883677
    Mammals – Fritz et al 2009 - 0.5 degree 0.2691
    Occurrence Density 27808.0 frequency
    Shannon Diversity (H) 6.3171644 index
    Species Richness 2593.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.7023324
    2030A1BMk35M: Evaporation - month min 89.16 mm
    2030A1BMk35M: Precipitation - annual mean 94.03 mm
    2030A1BMk35M: Precipitation - driest month 52.39 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.712252
    2030A1BMk35M: Precipitation - spring or autumn season -0.40233934
    2030A1BMk35M: Temperature - annual max mean 22.311666 degrees C
    2030A1BMk35M: Temperature - annual min mean 14.005 degrees C
    2030A1BMk35M: Temperature - annual range 16.720001 degrees C
    Aridity index - annual mean 0.8491015
    Aridity index - month max 2.0821116
    Aridity index - month min 0.3787848
    Evaporation - annual mean 142.54231 (ml/5km x 5km pixel)
    Evaporation - month max 224.36273 mm
    Evaporation - month min 68.2 mm
    Growth index C3 macrotherm plants - annual mean 0.17 index
    Growth index C3 mesotherm plants - annual mean 0.53 index
    Growth index C4 megatherm plants - annual mean 0.11 index
    Humidity - annual mean relative 81.34536 %
    Humidity - annual mean relative 3pm 77.12922 %
    Humidity - month max relative 84.27951 %
    Humidity - month max relative 3pm 79.21113 %
    Humidity - month min relative 74.94824 %
    Humidity - month min relative 3pm 74.94824 %
    Precipitation - annual (Bio12) 1193.0 mm
    Precipitation - annual mean 102.53134 mm
    Precipitation - annual seasonality 0.0038338439
    Precipitation - coldest quarter (Bio19) 273.0 mm
    Precipitation - driest month 70.00915 mm
    Precipitation - driest period (Bio14) 14.0 mm
    Precipitation - driest quarter (Bio17) 238.0 mm
    Precipitation - equinox seasonality ratio 0.6808754
    Precipitation - seasonality (Bio15) 20.0 mm
    Precipitation - spring or autumn season -0.46687382
    Precipitation - warmest quarter (Bio18) 314.0 mm
    Precipitation - wettest month 142.0 mm
    Precipitation - wettest period (Bio13) 31.0 mm
    Precipitation - wettest quarter (Bio16) 361.0 mm
    Radiation - annual mean (Bio20) 15.8 MJ/m2/day
    Radiation - seasonality (Bio23) 38.0
    Radiation - warmest quarter (Bio26) 21.2 MJ/m2/day
    Temperature - annual max mean 20.661667 degrees C
    Temperature - annual mean (Bio01) 17.0 degrees C
    Temperature - annual min mean 12.170834 degrees C
    Temperature - annual range 19.800018 degrees C
    Temperature - annual range (Bio07) 16.9 degrees C
    Temperature - coldest month min 7.47 degrees C
    Temperature - coldest period min (Bio06) 8.2 degrees C
    Temperature - coldest quarter mean (Bio11) 13.0 degrees C
    Temperature - diurnal range mean (Bio02) 8.2 degrees C
    Temperature - driest quarter mean (Bio09) 13.8 degrees C
    Temperature - isothermality (Bio03) 0.48 %
    Temperature - month hottest maximum 24.77 degrees C
    Temperature - seasonality (Bio04) 1.07
    Temperature - warmest month min 16.83 degrees C
    Temperature - warmest period max (Bio05) 25.1 degrees C
    Temperature - warmest quarter (Bio10) 20.9 degrees C
    Temperature - wettest quarter mean (Bio08) 16.0 degrees C
    Wind run - annual mean 281.02664 km/day
    WorldClim: Precipitation - annual 1374.0 mm
    WorldClim: Precipitation - coldest quarter 339.0 mm
    WorldClim: Precipitation - driest month 79.0 mm
    WorldClim: Precipitation - driest quarter 253.0 mm
    WorldClim: Precipitation - seasonality 23.0
    WorldClim: Precipitation - warmest quarter 390.0 mm
    WorldClim: Precipitation - wettest month 165.0 mm
    WorldClim: Precipitation - wettest quarter 417.0 mm
    WorldClim: Temperature - annual mean 168.0 degrees C * 10
    WorldClim: Temperature - annual range 170.0 degrees C * 10
    WorldClim: Temperature - coldest month min 79.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 124.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 81.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 129.0 degrees C * 10
    WorldClim: Temperature - isothermality 47.0 %
    WorldClim: Temperature - seasonality 3235.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 249.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 207.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 152.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.014142135 degrees
    Distance - to coast 0.01 km x 100
    Distance - to non-permanent water (weighted) 0.3244996 degrees
    Distance - to permanent water (weighted) 0.014142135 km
    Euclidean Distance to Coast (metres) 1031.4475 m
    Hydrology
    Water Observations From Space 0.31746033 Percentage
    Substrate
    2030A1BMk35M: Water stress index - month max 81.0
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 147.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.3 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 5.0 %
    Bulk density 1.3375616 Mg/m^3
    Clay % 9.884975 %
    Hydrologic conductivity - average saturated 300.0 mm/h
    Moisture Index - annual mean (Bio28) 0.75
    Moisture Index - highest quarter mean (Bio32) 0.99
    Nutrient status 1.0 index
    Soil depth 0.9 m
    Soil pedality 1.7256157
    Water holding capacity 29000.0 mm
    Water stress index - month max 81.0
    Weathering Intensity V2 4.9463 Weathering Intensity Index
    Topography
    Averaged Topographic Relief 87.75 metres
    Bathymetry and Elvation 9 sec 8.0 m
    Topographic Slope (degrees) 0.2641638 degrees
    Topographic relief 14.40376 m
    Topographic slope (%) 0.8325454 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.4594 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 89.0 %
    Gross Primary Productivity (2012-03-13) 0.0703 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 5.3 m^2 plant / m^2 ground
    Normalized Difference Vegetation Index (2012-03-05) 0.8502 NDVI