Occurrence record: BOLD - Australian records - 3774378

GenomicDNA of LEPIDOPTERA | Moths recorded on 1973-03-07

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3774378
Other catalogue numbers recordID:1650684;ProcessID:ANICI1000-10;sampleID:10ANIC-05997
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Upton, M.S.
Supplied as "M.S.Upton"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 1973-03-07
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Northern Territory
Local government area West Arnhem (S)
Locality Koongarra, 15 km E of Mt. Cahill
Latitude -12.52
Longitude 132.5
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HQ948718
markercode COI-5P
nucleotides AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCTGAATTAGGAACCCCTGGATCTTTAATTGGAGACGATCAAATTTATAATACTATTGTCACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCTTTAATATTAGGTGCCCCAGATATAGCTTTCCCCCGATTAAATAATATAAGTTTTTGATTATTACCTCCCTCTCTTACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCCCATAGAGGAAGATCAGTAGATTTAGCTATTTTTTCCCTTCATTTAGCAGGAATCTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACTGCATTTTTATTATTACTTTCTCTACCAGTATTAGCAGGAGCAATTACTATACTTTTAACAGATCGTAATTTAAATACATCATTCTTTGACCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:43Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Tropical Savanna Australian Tropical Savanna
    CAPAD 2010 Terrestrial Kakadu
    CAPAD 2012 Terrestrial Kakadu
    CAPAD 2014 Terrestrial Kakadu National Park
    CAPAD 2016 Terrestrial Kakadu
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Global 200 priority ecoregions - Terrestrial Northern Australia and Trans-Fly Savannas
    Important Bird Areas (IBA) Australia Kakadu Savanna IBA
    Irrigation practice - dominant No irrigation
    Land use Nature conservation
    NRM Regions 2010 Northern Territory
    NRM Regions 2014 Northern Territory
    NRM Regions 2015 Northern Territory
    NRM Regions 2017 Northern Territory
    NRM Regions 2017 (Qld 2019) Northern Territory
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Northern Territory
    Biodiversity
    Freshwater Ecoregions of the World Arafura - Carpentaria
    IBRA 6 Regions Darwin Coastal
    IBRA 6 Sub Regions Darwin Coastal
    IBRA 7 Regions Darwin Coastal
    IBRA 7 Subregions Darwin Coastal
    Terrestrial Ecoregional Boundaries Arnhem Land Tropical Savanna
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Strongly developed wet and dry seasons with plant growth determined by moisture availability
    Koppen Climate Classification (All Classes) Tropical: savanna
    Koppen Climate Classification (Major Classes) Tropical
    Fire
    Fire regime niches Eucalypt savanna woodland (monsoon tropical)
    Hydrology
    Drainage Divisions Level 1 Tanami-Timor Sea Coast
    Drainage Divisions Level 2 SOUTH ALLIGATOR RIVER
    River Regions SOUTH ALLIGATOR RIVER
    Marine
    Marine Ecoregions of the World Arnhem Coast to Gulf of Carpenteria
    States including coastal waters Northern Territory (including Coastal Waters)
    Political
    ASGS Australian States and Territories Northern Territory
    Australian States and Territories Northern Territory
    Commonwealth Electoral Boundaries Lingiari
    Local Government Areas 2011 West Arnhem (S)
    Local Government Areas 2012 deprecated South Alligator
    Local Government Areas PSMA 2018 WEST ARNHEM REGION
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 206
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 485
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF NT
    PSMA ABS SA2 Statistical Areas (2016) ALLIGATOR
    PSMA ABS SA3 Statistical Areas (2016) DALY - TIWI - WEST ARNHEM
    PSMA ABS SA4 Statistical Areas (2016) NORTHERN TERRITORY - OUTBACK
    PSMA Commonwealth Electoral Boundaries (2016) LINGIARI
    PSMA Commonwealth Electoral Boundaries (2018) LINGIARI
    PSMA Indigenous Areas (2016) KAKADU - MARRAKAI - JABIRU
    PSMA Indigenous Locations (2016) KAKADU - MARRAKAI - SURROUNDS
    PSMA Indigenous Regions (2016) JABIRU - TIWI
    PSMA Localities (2018) KAKADU
    PSMA Remoteness Areas (2016) Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (NT)
    PSMA State Electoral Boundaries (2016) ARAFURA
    PSMA State Electoral Boundaries (2018) ARAFURA
    PSMA States (2016) NORTHERN TERRITORY
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (NT)
    PSMA Wards (2018) KAKADU WARD
    Statistical Local Areas West Arnhem (S) Bal
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Pine Creek Region
    Surface Geology of Australia Czu
    Topography
    Physiographic Provinces of Australia North Australian Plateaus Province
    Physiographic Regions 2011 Top End Coastal Plains
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Indigenous managed, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Native forests and woodlands
    NVIS 4.1 Major Vegetation Groups Tropical Eucalypt Woodlands/Grasslands
    NVIS 4.1 Major Vegetation Subgroups Tropical Eucalyptus forest and woodlands with a tall annual grassy understorey
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Residual
    Vegetation types - native Tropical eucalypt woodlands/grasslands
    Vegetation types - present Tropical eucalypt woodlands/grasslands

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 1.0309905E7 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.7087
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.7138
    Endemism 0.0061685033
    Endemism (Non-marine) 0.0062459717
    Mammals – Fritz et al 2009 - 0.5 degree 0.2691
    Migratory species (2008) 9.0 frequency
    Occurrence Density 4541.0 frequency
    Shannon Diversity (H) 5.093964 index
    Species Richness 329.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 3.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.5984255
    2030A1BMk35M: Evaporation - month min 161.02 mm
    2030A1BMk35M: Precipitation - annual mean 111.10916 mm
    2030A1BMk35M: Precipitation - driest month 0.0 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.3388947
    2030A1BMk35M: Precipitation - spring or autumn season -1.9346803
    2030A1BMk35M: Temperature - annual max mean 34.809166 degrees C
    2030A1BMk35M: Temperature - annual min mean 23.24 degrees C
    2030A1BMk35M: Temperature - annual range 18.980011 degrees C
    Aridity index - annual mean 0.6812539
    Aridity index - month max 2.1393352
    Aridity index - month min 0.005302257
    Evaporation - annual mean 181.46588 (ml/5km x 5km pixel)
    Evaporation - average 26430.0 ml
    Evaporation - month max 236.69893 mm
    Evaporation - month min 140.69792 mm
    Evaporation - variability 7.0 %
    Growth index C3 macrotherm plants - annual mean 0.45 index
    Growth index C3 mesotherm plants - annual mean 0.13 index
    Growth index C4 megatherm plants - annual mean 0.42 index
    Humidity - annual mean relative 78.53078 %
    Humidity - annual mean relative 3pm 61.62537 %
    Humidity - month max relative 88.16878 %
    Humidity - month max relative 3pm 75.495255 %
    Humidity - month min relative 52.588467 %
    Humidity - month min relative 3pm 52.588467 %
    Precipitation - annual 1337.0 mm
    Precipitation - annual (Bio12) 1449.0 mm
    Precipitation - annual mean 111.4175 mm
    Precipitation - annual seasonality 11.948021
    Precipitation - coldest quarter (Bio19) 4.0 mm
    Precipitation - driest month 1.0 mm
    Precipitation - driest period (Bio14) 0.0 mm
    Precipitation - driest quarter (Bio17) 4.0 mm
    Precipitation - equinox seasonality ratio 0.44800594
    Precipitation - seasonality (Bio15) 112.0 mm
    Precipitation - spring or autumn season -1.2242156
    Precipitation - warmest quarter (Bio18) 386.0 mm
    Precipitation - wettest month 310.0 mm
    Precipitation - wettest period (Bio13) 85.0 mm
    Precipitation - wettest quarter (Bio16) 972.0 mm
    Radiation - annual mean (Bio20) 21.2 MJ/m2/day
    Radiation - seasonality (Bio23) 10.0
    Radiation - warmest quarter (Bio26) 23.6 MJ/m2/day
    Temperature - annual max mean 33.07 degrees C
    Temperature - annual mean (Bio01) 28.1 degrees C
    Temperature - annual min mean 21.744167 degrees C
    Temperature - annual range 21.100006 degrees C
    Temperature - annual range (Bio07) 19.3 degrees C
    Temperature - coldest month min 17.06 degrees C
    Temperature - coldest period min (Bio06) 17.8 degrees C
    Temperature - coldest quarter mean (Bio11) 25.3 degrees C
    Temperature - diurnal range mean (Bio02) 11.5 degrees C
    Temperature - driest quarter mean (Bio09) 25.3 degrees C
    Temperature - isothermality (Bio03) 0.6 %
    Temperature - month hottest maximum 36.08 degrees C
    Temperature - seasonality (Bio04) 0.63
    Temperature - warmest month min 24.37 degrees C
    Temperature - warmest period max (Bio05) 37.2 degrees C
    Temperature - warmest quarter (Bio10) 30.2 degrees C
    Temperature - wettest quarter mean (Bio08) 28.9 degrees C
    Wind run - annual mean 126.82017 km/day
    WorldClim: Precipitation - annual 1436.0 mm
    WorldClim: Precipitation - coldest quarter 5.0 mm
    WorldClim: Precipitation - driest month 1.0 mm
    WorldClim: Precipitation - driest quarter 5.0 mm
    WorldClim: Precipitation - seasonality 108.0
    WorldClim: Precipitation - warmest quarter 384.0 mm
    WorldClim: Precipitation - wettest month 332.0 mm
    WorldClim: Precipitation - wettest quarter 949.0 mm
    WorldClim: Temperature - annual mean 278.0 degrees C * 10
    WorldClim: Temperature - annual range 190.0 degrees C * 10
    WorldClim: Temperature - coldest month min 176.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 251.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 115.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 251.0 degrees C * 10
    WorldClim: Temperature - isothermality 60.0 %
    WorldClim: Temperature - seasonality 1804.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 366.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 299.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 285.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.041231055 degrees
    Distance - to coast 0.2213594 km x 100
    Distance - to non-permanent water (weighted) 0.089999996 degrees
    Distance - to permanent water (weighted) 0.041231055 km
    Euclidean Distance to Coast (metres) 30830.406 m
    Remoteness index 11.81181
    Fire
    Fire - time since last 11.0 years
    Fire frequency 1.0 frequency
    Hydrology
    Drainage - average 1812.0 megalitres/5x5km/year
    Drainage - variability 42.0 %
    Runoff - average 8479.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 0.0 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 81.0
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 95.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.55 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 23.0 %
    Bulk density 1.3445455 Mg/m^3
    Carbon - organic 0.25339663 %
    Clay % 12.909091 %
    Hydrologic conductivity - average saturated 300.0 mm/h
    Moisture Index - annual mean (Bio28) 0.5
    Moisture Index - highest quarter mean (Bio32) 1.0
    Nutrient status 1.0 index
    Ph - soil 4.0 ph
    Soil depth 0.6 m
    Soil pedality 2.0636363
    Water holding capacity 44000.0 mm
    Water stress index - month max 81.0
    Weathering Intensity V2 5.81758 Weathering Intensity Index
    Topography
    Aspect 178.0 degrees
    Averaged Topographic Relief 27.458334 metres
    Bathymetry and Elvation 9 sec 7.0 m
    Elevation 21.0 m
    Topographic Slope (degrees) 1.0225512 degrees
    Topographic relief 11.95073 m
    Topographic slope (%) 0.6116928 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.4138 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 62.0 %
    Gross Primary Productivity (2012-03-13) 0.0016 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 2.3 m^2 plant / m^2 ground
    NDVI Mean 60.0 NDVI x 100
    NPP Mean 4.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.7477 NDVI