Occurrence record: BOLD - Australian records - 3540249

GenomicDNA of LEPIDOPTERA | Moths recorded on 2009-04-13

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3540249
Other catalog numbers recordID:1417714;ProcessID:GWORX958-10;sampleID:BC EF Lep 02912
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Friedrich, E.
Supplied as "E. Friedrich"
Reproductive condition sexual
Sex male
Life stage adult
License CC-BY-Int
Field number BC EF Lep 02912
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Egbert Friedrich

Event

Field number BC EF Lep 02912
Record date 2009-04-13
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province Queensland
Locality Tablelands (R)
Locality Lake Euramoo
Latitude -17.1411
Longitude 145.626
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HM913159
markercode COI-5P
nucleotides AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCATTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAACTGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATGGTGGTAGATCCGTAGATTTAGCCATTTTTTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGAGCCATTAATTTTATTACTACAATTATTAATATACGATTAAATAATATATCTTTTGATCAAATATCTTTATTTATTTGAGCAGTAGGTATTACAGCATTTTTATTATTATTATCTTTACCAGTTTTAGCTGGAGCTATTACTATACTTTTAACAGATCGTAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTATATCAACATTTATTT
Owner institution code Research Collection of Egbert Friedrich
sequence last updated 2011-11-14T08:11:19Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Tropical Savanna Australian Tropical Savanna
    Fallow practice - dominant (area) Fallow 3-9 months
    Fallow practice - dominant (number) Fallow 3-9 months
    GER National Corridor GER National Corridor
    GER Standard Boundary GER Standard Boundary
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Marine Great Barrier Reef
    Global 200 priority ecoregions - Terrestrial Queensland Tropical Forests
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    Irrigation practice - dominant 6. Local knowledge
    Land use Plantations
    NRM Regions 2010 Wet Tropics
    NRM Regions 2014 Wet Tropics
    NRM Regions 2015 Wet Tropics
    NRM Regions 2017 Wet Tropics
    NRM Regions 2017 (Qld 2019) Wet Tropics
    Stubble practice - dominant (area) Stubble ploughed in
    Stubble practice - dominant (number) Stubble ploughed in
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 Wet Tropics
    Biodiversity
    Freshwater Ecoregions of the World Arafura - Carpentaria
    IBRA 6 Regions Wet Tropics
    IBRA 6 Sub Regions Bellenden Ker - Lamb
    IBRA 7 Regions Wet Tropics
    IBRA 7 Subregions Bellenden Ker-Lamb
    Terrestrial Ecoregional Boundaries Queensland Tropical Rain Forests
    World Anthropogenic Biomes (2000) Remote woodlands
    Climate
    Agroclimatic classification of Australia Strongly developed wet and dry seasons with cooler winter and with a growing season lasting at least six months
    Koppen Climate Classification (All Classes) Subtropical: no dry season
    Koppen Climate Classification (Major Classes) Subtropical
    Fire
    Fire regime niches Rainforest (tropical)
    Hydrology
    Drainage Divisions Level 1 North East Coast
    Drainage Divisions Level 2 BARRON RIVER
    River Regions BARRON RIVER
    Marine
    Marine Ecoregions of the World Central and Southern Great Barrier Reef
    States including coastal waters Queensland (including Coastal Waters)
    Political
    ASGS Australian States and Territories Queensland
    Australian States and Territories Queensland
    Commonwealth Electoral Boundaries Kennedy
    Indigenous Land Use Agreements Tableland Yidinji People and Tablelands Regional Council ILUA
    Local Government Areas 2011 Tablelands (R)
    Local Government Areas 2012 deprecated Atherton
    Local Government Areas PSMA 2018 TABLELANDS REGIONAL
    National Native Title Register (NNTR, Determinations of Native Title) - boundaries and core attributes Tableland Yidinji People
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 15
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 882
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF QLD
    PSMA ABS SA2 Statistical Areas (2016) MALANDA - YUNGABURRA
    PSMA ABS SA3 Statistical Areas (2016) TABLELANDS (EAST) - KURANDA
    PSMA ABS SA4 Statistical Areas (2016) CAIRNS
    PSMA Commonwealth Electoral Boundaries (2016) KENNEDY
    PSMA Commonwealth Electoral Boundaries (2018) KENNEDY
    PSMA Indigenous Areas (2016) ATHERTON
    PSMA Indigenous Locations (2016) ATHERTON
    PSMA Indigenous Regions (2016) CAIRNS - ATHERTON
    PSMA Localities (2018) DANBULLA
    PSMA Remoteness Areas (2016) Outer Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (QLD)
    PSMA State Electoral Boundaries (2016) DALRYMPLE
    PSMA State Electoral Boundaries (2018) HILL
    PSMA States (2016) QUEENSLAND
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (QLD)
    Statistical Local Areas Tablelands (R) - Atherton
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Cairns Region
    Surface Geology of Australia Dhho
    Topography
    Physiographic Provinces of Australia Peninsular Uplands Province
    Physiographic Regions 2011 Atherton Tableland
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Other special rights, Industrial plantation
    Forests of Australia (2013) v2.0 Softwood plantation
    Land cover Ephemeral and Permanent Water Features
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Multiple Use Forest
    Vegetation - condition Residual
    Vegetation types - native Rainforests and vine thickets
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Beef numbers 192173.0 dse
    Dairy numbers 51270.0 dse
    Natural resource management expenditure 4148781.0 $
    Natural resource management expenditure - additional 2.0 $/ha
    Sheep numbers 90.0 dse
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.5855
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 4.6877
    Endemism 0.03933265
    Endemism (Non-marine) 0.043356653
    Mammals – Fritz et al 2009 - 0.5 degree 0.5689
    Migratory species (2008) 7.0 frequency
    Occurrence Density 20150.0 frequency
    Shannon Diversity (H) 6.6097054 index
    Species Richness 2497.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 15.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.94278604
    2030A1BMk35M: Aridity index - month max 2.8116949
    2030A1BMk35M: Aridity index - month min 0.15575223
    2030A1BMk35M: Evaporation - annual mean 132.50166 mm
    2030A1BMk35M: Evaporation - month max 175.15 mm
    2030A1BMk35M: Evaporation - month min 89.11 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.48 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.59 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.38 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 73.78272 %
    2030A1BMk35M: Humidity - month max relative 3pm 78.98934 %
    2030A1BMk35M: Humidity - month min relative 3pm 66.30748 %
    2030A1BMk35M: Precipitation - annual mean 124.24333 mm
    2030A1BMk35M: Precipitation - driest month 26.0 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.28200895
    2030A1BMk35M: Precipitation - max difference between successive months 4.5570965 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -4.0750756 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 6.568828
    2030A1BMk35M: Precipitation - spring or autumn season -2.5272567
    2030A1BMk35M: Precipitation - summer or winter season 5.521207
    2030A1BMk35M: Precipitation - wettest month 355.82 mm
    2030A1BMk35M: Precipitation deficit - annual mean -8.258334 mm
    2030A1BMk35M: Precipitation deficit - month max -147.87 mm
    2030A1BMk35M: Precipitation deficit - month min 229.27 mm
    2030A1BMk35M: Radiation - max month precipitation modified 25.23 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 19.189167 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 14.6 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 26.804167 degrees C
    2030A1BMk35M: Temperature - annual min mean 17.2475 degrees C
    2030A1BMk35M: Temperature - annual range 17.170013 degrees C
    2030A1BMk35M: Temperature - coldest month min 13.15 degrees C
    2030A1BMk35M: Temperature - coolest month max 22.5 degrees C
    2030A1BMk35M: Temperature - max difference in max 2.4499817 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 2.1099854 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 11.75 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 9.556666 degrees C
    2030A1BMk35M: Temperature - min difference in max -1.8300171 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -2.6799927 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 7.600006 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 30.32 degrees C
    2030A1BMk35M: Temperature - warmest month min 20.88 degrees C
    Aridity index - annual mean 0.9925408
    Aridity index - month max 2.8066876
    Aridity index - month min 0.17639431
    Evaporation - annual mean 134.42021 (ml/5km x 5km pixel)
    Evaporation - average 26425.0 ml
    Evaporation - month max 183.18936 mm
    Evaporation - month min 87.869965 mm
    Evaporation - variability 14.0 %
    Growth index C3 macrotherm plants - annual mean 0.4 index
    Growth index C3 mesotherm plants - annual mean 0.61 index
    Growth index C4 megatherm plants - annual mean 0.3 index
    Humidity - annual mean relative 83.99687 %
    Humidity - annual mean relative 3pm 73.09193 %
    Humidity - month max relative 90.15309 %
    Humidity - month max relative 3pm 78.26469 %
    Humidity - month min relative 65.7961 %
    Humidity - month min relative 3pm 65.7961 %
    Precipitation - annual 1529.0 mm
    Precipitation - annual (Bio12) 1562.0 mm
    Precipitation - annual (log) seasonality index 0.21647972
    Precipitation - annual mean 130.20027 mm
    Precipitation - annual seasonality 2.5418777
    Precipitation - annual seasonality ratio 3.549279
    Precipitation - autumn 525.0 mm
    Precipitation - autumn reliability 50.0 %
    Precipitation - coldest quarter (Bio19) 128.0 mm
    Precipitation - driest month 26.0 mm
    Precipitation - driest period (Bio14) 5.0 mm
    Precipitation - driest quarter (Bio17) 98.0 mm
    Precipitation - equinox seasonality ratio 0.2490601
    Precipitation - max difference between successive months 4.922241 mm/day
    Precipitation - min difference between successive months -6.0217557 mm/day
    Precipitation - seasonality (Bio15) 84.0 mm
    Precipitation - solstice seasonality ratio 6.783515
    Precipitation - spring 129.0 mm
    Precipitation - spring or autumn (log) season -0.28381363
    Precipitation - spring or autumn season -2.992134
    Precipitation - spring reliability 28.0 %
    Precipitation - summer 794.0 mm
    Precipitation - summer or winter (log) season 0.39994583
    Precipitation - summer or winter season 5.7344055
    Precipitation - summer reliability 52.0 %
    Precipitation - warmest quarter (Bio18) 737.0 mm
    Precipitation - wettest month 346.76837 mm
    Precipitation - wettest period (Bio13) 87.0 mm
    Precipitation - wettest quarter (Bio16) 897.0 mm
    Precipitation - winter 117.0 mm
    Precipitation - winter reliability 33.0 %
    Precipitation deficit - annual mean -4.219935 mm
    Precipitation deficit - month max -150.8758 mm
    Precipitation deficit - month min 223.21762 mm
    Radiation - annual mean (Bio20) 19.0 MJ/m2/day
    Radiation - coldest quarter (Bio27) 16.1 MJ/m2/day
    Radiation - driest quarter (Bio25) 19.5 MJ/m2/day
    Radiation - highest period (Bio21) 25.4 MJ/m2/day
    Radiation - lowest period (Bio22) 14.3 MJ/m2/day
    Radiation - max month precipitation modified 25.468643 MJ/m2/day
    Radiation - mean annual precipitation modified 19.146704 MJ/m2/day
    Radiation - min month precipitation modified 14.5 MJ/m2/day
    Radiation - seasonality (Bio23) 18.0
    Radiation - warmest quarter (Bio26) 21.4 MJ/m2/day
    Radiation - wettest quarter (Bio24) 18.9 MJ/m2/day
    Temperature - annual max mean 25.164167 degrees C
    Temperature - annual mean (Bio01) 21.2 degrees C
    Temperature - annual min mean 15.5475 degrees C
    Temperature - annual range 16.931366 degrees C
    Temperature - annual range (Bio07) 17.3 degrees C
    Temperature - coldest month min 11.46 degrees C
    Temperature - coldest period min (Bio06) 12.3 degrees C
    Temperature - coldest quarter mean (Bio11) 17.5 degrees C
    Temperature - coolest month max 20.93 degrees C
    Temperature - diurnal range mean (Bio02) 9.5 degrees C
    Temperature - driest quarter mean (Bio09) 19.3 degrees C
    Temperature - isothermality (Bio03) 0.55 %
    Temperature - max absolute mean max 38.0 degrees C
    Temperature - max difference in max 2.4100037 degrees C/day
    Temperature - max difference in min 2.0700073 degrees C/day
    Temperature - max month diurnal range 11.720001 degrees C
    Temperature - mean annual absolute mean min 5.3933334 degrees C
    Temperature - mean annual diurnal range 9.616664 degrees C
    Temperature - min absolute mean min -0.528 degrees C
    Temperature - min difference in max -1.8999939 degrees C/day
    Temperature - min difference in min -2.8199768 degrees C/day
    Temperature - min month diurnal range 7.930023 degrees C
    Temperature - month hottest maximum 28.69 degrees C
    Temperature - month mean absolute max 33.142334 degrees C
    Temperature - seasonality (Bio04) 0.91
    Temperature - warmest month min 19.21 degrees C
    Temperature - warmest period max (Bio05) 29.6 degrees C
    Temperature - warmest quarter (Bio10) 24.2 degrees C
    Temperature - wettest quarter mean (Bio08) 23.8 degrees C
    Vapour pressure deficit - annual mean 0.28247553 KPa
    Vapour pressure deficit - annual mean 9am 0.40633443 KPa
    Vapour pressure deficit - month max 0.6485591 KPa
    Vapour pressure deficit - month max 9am 0.6485591 KPa
    Vapour pressure deficit - month min 0.09349942 KPa
    Vapour pressure deficit - month min 9am 0.2322278 KPa
    Wind run - annual mean 163.81038 km/day
    Wind run - month max 189.65419 km/day
    Wind run - month min 142.39883 km/day
    Wind speed - annual mean 3pm 3.0306938 m/s
    Wind speed - annual mean 9am 2.91711 m/s
    Wind speed - annual mean 9am or 3pm 3.65 m/s
    Wind speed - month max 3pm 3.7 m/s
    Wind speed - month max 9am 3.6 m/s
    Wind speed - month max 9am or 3pm 3.7 m/s
    Wind speed - month min 3pm 2.5 m/s
    Wind speed - month min 9am 2.2 m/s
    Wind speed - month min 9am or 3pm 2.2 m/s
    WorldClim: Precipitation - annual 2156.0 mm
    WorldClim: Precipitation - coldest quarter 197.0 mm
    WorldClim: Precipitation - driest month 47.0 mm
    WorldClim: Precipitation - driest quarter 148.0 mm
    WorldClim: Precipitation - seasonality 76.0
    WorldClim: Precipitation - warmest quarter 960.0 mm
    WorldClim: Precipitation - wettest month 424.0 mm
    WorldClim: Precipitation - wettest quarter 1195.0 mm
    WorldClim: Temperature - annual mean 210.0 degrees C * 10
    WorldClim: Temperature - annual range 173.0 degrees C * 10
    WorldClim: Temperature - coldest month min 117.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 173.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 98.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 196.0 degrees C * 10
    WorldClim: Temperature - isothermality 56.0 %
    WorldClim: Temperature - seasonality 2605.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 290.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 239.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 236.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.2745906 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.01 km
    Euclidean Distance to Coast (metres) 30866.922 m
    Remoteness index 4.994652
    Hydrology
    Drainage - average 516.0 megalitres/5x5km/year
    Drainage - variability 145.0 %
    Runoff - average 5920.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Marine
    Great Barrier Reef 100m DEM 733.84 m
    Social
    Age 41.899975 years
    Age - prime group 22.6001 Count
    Disadvantaged 983.9209 points (mean=1000)
    Education - degrees 9.599945 %
    Education - vocational training 24.900072 %
    Employment 13.100155 %
    Home ownership 62.300182 %
    Income - high 22.900146 %
    Income - low 17.699924 %
    Internet 49.60005 %
    Population - change 9.099915 count
    Population - density SLA 2006 p/sqkm) 17.499624 people/km^2
    Unemployment rate 2.7999778 %
    Work force - older 27.30006 Count
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.7447502
    2030A1BMk35M: Crop factor - month max 0.9
    2030A1BMk35M: Crop factor - month min 0.15575223
    2030A1BMk35M: Water deficit - month max 44.2022 mm
    2030A1BMk35M: Water deficit - month mean 10.504491 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -0.59804064 MPa
    2030A1BMk35M: Water potential - month max -2.8643754E-14 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 67.02751
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 14.017699
    2030A1BMk35M: Water surplus - annual mean 30.465918 mm
    2030A1BMk35M: Water surplus - month max 190.66403 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 62.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.46 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 36.0 %
    Bouguer gravity anomalies -73.34721 Gal
    Bulk density 1.1230276 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic 1.2353787 %
    Carbon store pre-European 124.7335 kgC/ha
    Clay % 38.651375 %
    Crop factor - annual mean 0.73465914
    Crop factor - month max 0.90000004
    Crop factor - month min 0.17639431
    Erodibility 54.0 k factor
    Erosional surfaces - proportion 100.0 %
    Erosivity 7988.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 136.36363 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 47.5 my
    Lithology - fertility 4.0 index
    Lithology - mean age 296.675 my
    Lithology - mean age (log) 2.472281 log my
    Lithology - mean age range (log) 1.6766936 log my
    Magnetic anomalies -74.0 nT
    Moisture - average 51.0 %
    Moisture - variability 10.0 %
    Moisture Index - annual mean (Bio28) 0.75
    Moisture Index - coldest quarter mean (Bio35) 0.83
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 1.0
    Moisture Index - lowest period (Bio30) 0.16
    Moisture Index - lowest quarter mean (Bio33) 0.29
    Moisture Index - seasonality (Bio31) 40.0
    Moisture Index - warmest quarter mean (Bio34) 0.84
    Nitrogen - plant-available pre-European 10769.95 kgN/ha
    Nitrogen concentration pre-European 56.88002 mgN kg/H2O
    Nitrogen store pre-European 183.6142 kgN/ha
    Nutrient status 2.0 index
    Pedality hydrological score 4.1091743
    Ph - soil 4.0 ph
    Phosphorus - plant-available pre-European 33.81228 kgP/ha
    Phosphorus - plant-available total pre-European 1643.4297 kgP/ha
    Phosphorus pre-European 10.47437 mgP kg/H2O
    Soil depth 1.1 m
    Soil pedality 4.1091743
    Soils - coarse 0.0 class
    Substrate data reliability 3.0
    Topographic wetness index 6.834169
    Unreliable water retention parameters 0.0
    Water deficit - month max 53.435432 mm
    Water deficit - month mean 11.855335 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 41250.0 mm
    Water holding capacity - plant-available 187.0 mm
    Water potential - annual mean -0.61255544 MPa
    Water potential - month max -2.8643754E-14 MPa
    Water potential - month min -1.5 MPa
    Water stress index - annual mean 66.11932
    Water stress index - month max 81.0
    Water stress index - month min 15.875486
    Water surplus - annual mean 37.24803 mm
    Water surplus - month max 207.52881 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 2.56368 Weathering Intensity Index
    Topography
    Aspect 211.0 degrees
    Averaged Topographic Relief 621.3333 metres
    Bathymetry and Topography 9 sec 685.0 m
    Elevation 679.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Slope length 1000.0 m
    Topographic Slope (degrees) 0.798512 degrees
    Topographic relief 32.03381 m
    Topographic roughness 1.389763 %
    Topographic slope (%) 2.043053 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 0.0
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.5398 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 44.0 %
    Gross Primary Productivity (2012-03-13) 0.0028 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 1.1 m^2 plant / m^2 ground
    NDVI Mean 86.0 NDVI x 100
    NPP Mean 17.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.877 NDVI