Occurrence record:

EnvironmentalDNA of Fungi recorded on 2015-01-29

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated sequences https://www.ncbi.nlm.nih.gov/biosample/SAMN07483646
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2015-01-29
Date precision Day

Taxonomy

Scientific name Fungi
Taxon rank kingdom
Kingdom Fungi
Phylum Fungi unclassified
Class Fungi unclassified
Order Fungi unclassified
Family Fungi unclassified
Genus Fungi unclassified
Species Fungi unclassified
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type wellformed

Geospatial

Country Australia
State / Province Tasmania
Locality Waratah/Wynyard (M)
Locality Pieman River
Latitude -41.65563
Longitude 145.08186
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial
Verbatim elevation 16.0

Additional properties

ammonium nitrogen mg kg 40.0
amplicon ITS1FITS4_fungi
boron hot cacl2 mg kg 0.8
broad land use Conservation and Natural Environments
clay 28.48
color GRBR
conductivity dsm ds m 0.111
course sand 5.52
depth m 20.0
detailed land use Conservation and Natural Environments - Nature conservation - Protected landscape
dtpa copper mg kg 4.22
dtpa iron mg kg 455.78
dtpa manganese mg kg 1.7
dtpa zinc mg kg 4.92
environment Soil
exc aluminium meq 100g 0.715
exc calcium meq 100g 4.61
exc magnesium meq 100g 3.07
exc potassium meq 100g 0.14
exc sodium meq 100g 0.36
fine sand 41.24
general ecological zone Temperate
gravel 5.0
ncbi bioproject accession PRJNA317932
ncbi biosample accession SAMN07483646
nitrate nitrogen mg kg 1e-10
otu CAATAAGTGTTTATGGCACTTTCAAATCCATACCCACCTTGTGTGCATTGTAAGGGCCCTTTCAACTCTCGCTCTCCCTCTCTCCCTTGGGAGGGAGGGGAAGAAGGCAGACTGGGCTTCATTTTCTCACACGTCTTCAATTGCAAGTCTAACATTCAGAGTAATCAAAACTCGAATA
otucount 2
organic carbon 4.9
ph level cacl2 cacl2 4.6
ph level h2o h2o 5.5
phosphorus colwell mg kg 14.0
potassium colwell mg kg 65.0
sample id 102.100.100/14186
sample type Soil
sand 46.76
silt 24.76
slope 0.0
sulphur mg kg 18.9
texture 2.0
vegetation type Forest
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Altitude out of range Passed
    Altitude value non-numeric Passed
    Altitude value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 12 missing properties
    Show/Hide 45 tests that have not been run

    Additional political boundaries information

    Area Management
    CAPAD 2010 Terrestrial Pieman River
    CAPAD 2012 Terrestrial Pieman River
    CAPAD 2014 Terrestrial Pieman River
    CAPAD 2016 Terrestrial Pieman River
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Global 200 priority ecoregions - Terrestrial Tasmanian Temperate Rainforests
    Land use Nature conservation
    NRM Regions 2010 North West
    NRM Regions 2014 North West TAS
    NRM Regions 2015 North West
    NRM Regions 2017 North West NRM Region
    NRM Regions 2017 (Qld 2019) North West NRM Region
    Area management
    National Landcare Program Management Units 2018 North West NRM Region
    Biodiversity
    Freshwater Ecoregions of the World Southern Tasmania
    IBRA 6 Regions Tasmanian West
    IBRA 6 Sub Regions West
    IBRA 7 Regions Tasmanian West
    IBRA 7 Subregions West
    Terrestrial Ecoregional Boundaries Tasmanian Temperate Rain Forests
    World Anthropogenic Biomes (2000) Populated rangelands
    Climate
    Agroclimatic classification of Australia Less severe winters and longer moist summers suitable for some crops
    Koppen Climate Classification (All Classes) Temperate: no dry season (mild summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Rainforest (temperate)
    Hydrology
    Drainage Divisions Level 1 Tasmania
    Drainage Divisions Level 2 PIEMAN RIVER
    River Regions PIEMAN RIVER
    Marine
    Marine Ecoregions of the World Bassian
    States including coastal waters Tasmania (including Coastal Waters)
    Political
    ASGS Australian States and Territories Tasmania
    Australian States and Territories Tasmania
    Commonwealth Electoral Boundaries Braddon
    Local Government Areas 2011 Waratah/Wynyard (M)
    Local Government Areas 2012 deprecated Waratah/Wynyard - Pt B
    Local Government Areas PSMA 2018 WARATAH-WYNYARD COUNCIL
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 3
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 3932
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF TAS.
    PSMA ABS SA2 Statistical Areas (2016) WARATAH
    PSMA ABS SA3 Statistical Areas (2016) WEST COAST
    PSMA ABS SA4 Statistical Areas (2016) WEST AND NORTH WEST
    PSMA Commonwealth Electoral Boundaries (2016) BRADDON
    PSMA Commonwealth Electoral Boundaries (2018) BRADDON
    PSMA Indigenous Areas (2016) TASMANIA - WEST COAST
    PSMA Indigenous Locations (2016) WARATAH
    PSMA Indigenous Regions (2016) TASMANIA
    PSMA Localities (2018) CORINNA
    PSMA Remoteness Areas (2016) Outer Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (TAS.)
    PSMA State Electoral Boundaries (2016) MURCHISON
    PSMA State Electoral Boundaries (2018) MURCHISON
    PSMA States (2016) TASMANIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (TAS.)
    Statistical Local Areas Waratah/Wynyard (M) - Pt B
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Rocky Cape Region
    Surface Geology of Australia Nsg
    Topography
    Physiographic Provinces of Australia Tasmanian Uplands Province
    Physiographic Regions 2011 West Tasmanian Ridges
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Native forest
    Forests of Australia (2013) v2.0 Rainforest
    Land cover Native shrublands and heathlands
    NVIS 4.1 Major Vegetation Groups Rainforests and Vine Thickets
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve
    Vegetation - condition Replaced
    Vegetation types - native Rainforests and vine thickets
    Vegetation types - present Rainforest and vine thickets

    Environmental sampling for this location

    Area Management
    Beef numbers 96962.0 dse
    Dairy numbers 147818.0 dse
    Natural resource management expenditure 4058626.0 $
    Natural resource management expenditure - additional 1.0 $/ha
    Sheep numbers 3328.0 dse
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.3518
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.2931
    Endemism 0.03231931
    Endemism (Non-marine) 0.036997456
    Mammals – Fritz et al 2009 - 0.5 degree 0.2867
    Migratory species (2008) 3.0 frequency
    Occurrence Density 5706.0 frequency
    Shannon Diversity (H) 6.275372 index
    Species Richness 1335.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 3.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 2.2899206
    2030A1BMk35M: Aridity index - month max 5.462985
    2030A1BMk35M: Aridity index - month min 0.58390456
    2030A1BMk35M: Evaporation - annual mean 84.61916 mm
    2030A1BMk35M: Evaporation - month max 144.45 mm
    2030A1BMk35M: Evaporation - month min 41.47 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.07 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.48 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.05 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 83.79989 %
    2030A1BMk35M: Humidity - month max relative 3pm 88.54275 %
    2030A1BMk35M: Humidity - month min relative 3pm 78.44897 %
    2030A1BMk35M: Precipitation - annual mean 139.62083 mm
    2030A1BMk35M: Precipitation - driest month 72.41 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.0405992
    2030A1BMk35M: Precipitation - max difference between successive months 1.2499787 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -1.6968491 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 0.42803207
    2030A1BMk35M: Precipitation - spring or autumn season 0.040495217
    2030A1BMk35M: Precipitation - summer or winter season -1.331234
    2030A1BMk35M: Precipitation - wettest month 226.55 mm
    2030A1BMk35M: Precipitation deficit - annual mean 55.001667 mm
    2030A1BMk35M: Precipitation deficit - month max -54.269997 mm
    2030A1BMk35M: Precipitation deficit - month min 185.08 mm
    2030A1BMk35M: Radiation - max month precipitation modified 20.63 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 11.94 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 3.85 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 17.135834 degrees C
    2030A1BMk35M: Temperature - annual min mean 8.8741665 degrees C
    2030A1BMk35M: Temperature - annual range 16.040009 degrees C
    2030A1BMk35M: Temperature - coldest month min 5.9 degrees C
    2030A1BMk35M: Temperature - coolest month max 12.89 degrees C
    2030A1BMk35M: Temperature - max difference in max 1.8999939 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 1.3900146 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 9.839996 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 8.26167 degrees C
    2030A1BMk35M: Temperature - min difference in max -2.3299866 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -1.8500061 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 6.9599915 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 21.94 degrees C
    2030A1BMk35M: Temperature - warmest month min 12.1 degrees C
    Aridity index - annual mean 2.9742155
    Aridity index - month max 6.8993926
    Aridity index - month min 0.66744536
    Evaporation - annual mean 79.46972 (ml/5km x 5km pixel)
    Evaporation - average 17438.0 ml
    Evaporation - month max 147.02237 mm
    Evaporation - month min 29.76118 mm
    Evaporation - variability 7.0 %
    Growth index C3 macrotherm plants - annual mean 0.04 index
    Growth index C3 mesotherm plants - annual mean 0.41 index
    Growth index C4 megatherm plants - annual mean 0.03 index
    Humidity - annual mean relative 88.240555 %
    Humidity - annual mean relative 3pm 82.91407 %
    Humidity - month max relative 94.90618 %
    Humidity - month max relative 3pm 87.9353 %
    Humidity - month min relative 77.57181 %
    Humidity - month min relative 3pm 77.57181 %
    Precipitation - annual 1897.0 mm
    Precipitation - annual (Bio12) 1792.0 mm
    Precipitation - annual (log) seasonality index -0.07563478
    Precipitation - annual mean 156.85294 mm
    Precipitation - annual seasonality -0.6435468
    Precipitation - annual seasonality ratio 0.60810566
    Precipitation - autumn 467.0 mm
    Precipitation - autumn reliability 80.0 %
    Precipitation - coldest quarter (Bio19) 636.0 mm
    Precipitation - driest month 97.38818 mm
    Precipitation - driest period (Bio14) 20.0 mm
    Precipitation - driest quarter (Bio17) 280.0 mm
    Precipitation - equinox seasonality ratio 1.0143422
    Precipitation - max difference between successive months 1.6835972 mm/day
    Precipitation - min difference between successive months -1.0311828 mm/day
    Precipitation - seasonality (Bio15) 32.0 mm
    Precipitation - solstice seasonality ratio 0.49341598
    Precipitation - spring 468.0 mm
    Precipitation - spring or autumn (log) season 0.0023163485
    Precipitation - spring or autumn season 0.01431116
    Precipitation - spring reliability 85.0 %
    Precipitation - summer 320.0 mm
    Precipitation - summer or winter (log) season -0.12242556
    Precipitation - summer or winter season -1.0234425
    Precipitation - summer reliability 67.0 %
    Precipitation - warmest quarter (Bio18) 282.0 mm
    Precipitation - wettest month 225.94298 mm
    Precipitation - wettest period (Bio13) 58.0 mm
    Precipitation - wettest quarter (Bio16) 636.0 mm
    Precipitation - winter 641.0 mm
    Precipitation - winter reliability 83.0 %
    Precipitation deficit - annual mean 77.383224 mm
    Precipitation deficit - month max -48.892975 mm
    Precipitation deficit - month min 193.19473 mm
    Radiation - annual mean (Bio20) 11.7 MJ/m2/day
    Radiation - coldest quarter (Bio27) 5.2 MJ/m2/day
    Radiation - driest quarter (Bio25) 17.9 MJ/m2/day
    Radiation - highest period (Bio21) 20.7 MJ/m2/day
    Radiation - lowest period (Bio22) 3.5 MJ/m2/day
    Radiation - max month precipitation modified 20.2 MJ/m2/day
    Radiation - mean annual precipitation modified 11.566134 MJ/m2/day
    Radiation - min month precipitation modified 3.8 MJ/m2/day
    Radiation - seasonality (Bio23) 54.0
    Radiation - warmest quarter (Bio26) 18.6 MJ/m2/day
    Radiation - wettest quarter (Bio24) 5.2 MJ/m2/day
    Temperature - annual max mean 15.39 degrees C
    Temperature - annual mean (Bio01) 12.2 degrees C
    Temperature - annual min mean 7.4241667 degrees C
    Temperature - annual range 15.5 degrees C
    Temperature - annual range (Bio07) 16.2 degrees C
    Temperature - coldest month min 4.58 degrees C
    Temperature - coldest period min (Bio06) 5.1 degrees C
    Temperature - coldest quarter mean (Bio11) 9.0 degrees C
    Temperature - coolest month max 11.14 degrees C
    Temperature - diurnal range mean (Bio02) 8.2 degrees C
    Temperature - driest quarter mean (Bio09) 15.6 degrees C
    Temperature - isothermality (Bio03) 0.51 %
    Temperature - max absolute mean max 35.0 degrees C
    Temperature - max difference in max 1.8500061 degrees C/day
    Temperature - max difference in min 1.3999939 degrees C/day
    Temperature - max month diurnal range 9.709991 degrees C
    Temperature - mean annual absolute mean min -0.049700662 degrees C
    Temperature - mean annual diurnal range 7.965841 degrees C
    Temperature - min absolute mean min -2.733312 degrees C
    Temperature - min difference in max -2.5100098 degrees C/day
    Temperature - min difference in min -1.8800049 degrees C/day
    Temperature - min month diurnal range 6.5599976 degrees C
    Temperature - month hottest maximum 20.31 degrees C
    Temperature - month mean absolute max 28.967445 degrees C
    Temperature - seasonality (Bio04) 0.9
    Temperature - warmest month min 10.6 degrees C
    Temperature - warmest period max (Bio05) 21.3 degrees C
    Temperature - warmest quarter (Bio10) 15.6 degrees C
    Temperature - wettest quarter mean (Bio08) 9.0 degrees C
    Vapour pressure deficit - annual mean 0.039032493 KPa
    Vapour pressure deficit - annual mean 9am 0.15168472 KPa
    Vapour pressure deficit - month max 0.29675412 KPa
    Vapour pressure deficit - month max 9am 0.29675412 KPa
    Vapour pressure deficit - month min 0.0 KPa
    Vapour pressure deficit - month min 9am 0.073001266 KPa
    Wind run - annual mean 161.30167 km/day
    Wind run - month max 186.59947 km/day
    Wind run - month min 140.0991 km/day
    Wind speed - annual mean 3pm 3.4583333 m/s
    Wind speed - annual mean 9am 2.3833334 m/s
    Wind speed - annual mean 9am or 3pm 3.6 m/s
    Wind speed - month max 3pm 4.1 m/s
    Wind speed - month max 9am 3.1 m/s
    Wind speed - month max 9am or 3pm 4.1 m/s
    Wind speed - month min 3pm 2.7 m/s
    Wind speed - month min 9am 1.9 m/s
    Wind speed - month min 9am or 3pm 1.9 m/s
    WorldClim: Precipitation - annual 1783.0 mm
    WorldClim: Precipitation - coldest quarter 635.0 mm
    WorldClim: Precipitation - driest month 76.0 mm
    WorldClim: Precipitation - driest quarter 268.0 mm
    WorldClim: Precipitation - seasonality 32.0
    WorldClim: Precipitation - warmest quarter 268.0 mm
    WorldClim: Precipitation - wettest month 235.0 mm
    WorldClim: Precipitation - wettest quarter 635.0 mm
    WorldClim: Temperature - annual mean 121.0 degrees C * 10
    WorldClim: Temperature - annual range 148.0 degrees C * 10
    WorldClim: Temperature - coldest month min 56.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 90.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 76.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 153.0 degrees C * 10
    WorldClim: Temperature - isothermality 51.0 %
    WorldClim: Temperature - seasonality 2442.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 204.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 153.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 90.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.1345362 km x 100
    Distance - to non-permanent water (weighted) 0.12727922 degrees
    Distance - to permanent water (weighted) 0.0 km
    Euclidean Distance to Coast (metres) 7957.048 m
    Remoteness index 10.575699
    Hydrology
    Drainage - average 7908.0 megalitres/5x5km/year
    Drainage - variability 9.0 %
    Runoff - average 17340.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Disadvantaged 957.1138 points (mean=1000)
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.8994074
    2030A1BMk35M: Crop factor - month max 0.90000004
    2030A1BMk35M: Crop factor - month min 0.89288914
    2030A1BMk35M: Water deficit - month max 0.0 mm
    2030A1BMk35M: Water deficit - month mean 0.0 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -0.075484864 MPa
    2030A1BMk35M: Water potential - month max -2.8643754E-14 MPa
    2030A1BMk35M: Water potential - month min -0.3650732 MPa
    2030A1BMk35M: Water stress index - annual mean 80.94666
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 80.36002
    2030A1BMk35M: Water surplus - annual mean 63.522633 mm
    2030A1BMk35M: Water surplus - month max 189.22699 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 81.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 0.86 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 18.0 %
    Bouguer gravity anomalies 189.9433 Gal
    Bulk density 1.4060701 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic 2.7765825 %
    Carbon store pre-European 276.783 kgC/ha
    Clay % 43.5307 %
    Crop factor - annual mean 0.9
    Crop factor - month max 0.9
    Crop factor - month min 0.8999999
    Erodibility 4.0 k factor
    Erosional surfaces - proportion 100.0 %
    Erosivity 2498.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 44.0 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 487.0 my
    Lithology - fertility 6.0 index
    Lithology - mean age 649.25 my
    Lithology - mean age (log) 2.812412 log my
    Lithology - mean age range (log) 2.6875288 log my
    Magnetic anomalies 240.0 nT
    Moisture - average 81.0 %
    Moisture - variability 4.0 %
    Moisture Index - annual mean (Bio28) 0.97
    Moisture Index - coldest quarter mean (Bio35) 1.0
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 1.0
    Moisture Index - lowest period (Bio30) 0.81
    Moisture Index - lowest quarter mean (Bio33) 0.88
    Moisture Index - seasonality (Bio31) 6.0
    Moisture Index - warmest quarter mean (Bio34) 0.91
    Nitrogen - plant-available pre-European 22416.02 kgN/ha
    Nitrogen concentration pre-European 52.01896 mgN kg/H2O
    Nitrogen store pre-European 247.8902 kgN/ha
    Nutrient status 1.8 index
    Pedality hydrological score 3.7407017
    Ph - soil 4.0 ph
    Phosphorus - plant-available pre-European 45.39712 kgP/ha
    Phosphorus - plant-available total pre-European 3496.3252 kgP/ha
    Phosphorus pre-European 9.526441 mgP kg/H2O
    Soil depth 1.6 m
    Soil pedality 3.7407017
    Soils - coarse 0.0 class
    Substrate data reliability 2.0
    Topographic wetness index 13.07939
    Unreliable water retention parameters 0.0
    Water deficit - month max 0.0 mm
    Water deficit - month mean 0.0 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 65000.0 mm
    Water holding capacity - plant-available 167.0 mm
    Water potential - annual mean -0.014729077 MPa
    Water potential - month max -2.8643754E-14 MPa
    Water potential - month min -0.091755435 MPa
    Water stress index - annual mean 80.99999
    Water stress index - month max 81.0
    Water stress index - month min 80.99999
    Water surplus - annual mean 85.3302 mm
    Water surplus - month max 196.46957 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 1.66977 Weathering Intensity Index
    Topography
    Aspect 111.0 degrees
    Averaged Topographic Relief 129.75 metres
    Bathymetry and Topography 9 sec 37.0 m
    Elevation 71.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Slope length 1000.0 m
    Topographic Slope (degrees) 0.6667196 degrees
    Topographic relief 53.30854 m
    Topographic roughness 52.93045 %
    Topographic slope (%) 5.051916 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 0.0
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.4103 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 40.0 %
    Fractional Cover - Bare Soil (2012-03-05) 0.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 31.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 69.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0459 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 1.0 m^2 plant / m^2 ground
    NDVI Mean 84.0 NDVI x 100
    NPP Mean 7.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.8716 NDVI
    Phenology peak day of year 2002 dry 80.38461 Day
    Phenology peak day of year 2012 wet 18.548388 Day