Occurrence record: BOLD - Australian records - 3749391

GenomicDNA of LEPIDOPTERA | Moths recorded on 2006-12-15

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3749391
Other catalog numbers recordID:1652022;ProcessID:ANICK338-10;sampleID:10ANIC-07335
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Rentz, D.C.F.
Supplied as "D.C.F.Rentz"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2006-12-15
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province Queensland
Locality Cairns (R)
Locality 19 Butler Dr, Top of the Range
Latitude -16.48
Longitude 145.38
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HQ950436
markercode COI-5P
nucleotides AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACCTCATTAAGTTTATTAATTCGAGCAGAATTAGGTAATCCTGGTTCATTAATCGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAACTGATTAGTTCCTCTAATATTAGGAGCCCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTCTGACTTCTTCCCCCATCCCTAACTTTATTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTTTACCCCCCTTTATCATCAAATATTGCCCATAGAGGAAGATCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCCTCAATTTTAGGAGCTATTAATTTTATTACTACAATCATTAATATACGATTAAATAATTTAATATTTGACCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACTGCATTTTTACTACTTTTATCTTTACCTGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGACCCAGCTGGAGGGGGAGATCCTATTTTATACCAACATTTATTT
Owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:43Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Tropical Savanna Australian Tropical Savanna
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    GER National Corridor GER National Corridor
    GER Standard Boundary GER Standard Boundary
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Marine Great Barrier Reef
    Global 200 priority ecoregions - Terrestrial Queensland Tropical Forests
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    Irrigation practice - dominant No irrigation
    Land use Cropping
    NRM Regions 2010 Wet Tropics
    NRM Regions 2014 Wet Tropics
    NRM Regions 2015 Wet Tropics
    NRM Regions 2017 Wet Tropics
    NRM Regions 2017 (Qld 2019) Wet Tropics
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Wet Tropics
    Biodiversity
    Freshwater Ecoregions of the World Arafura - Carpentaria
    IBRA 6 Regions Wet Tropics
    IBRA 6 Sub Regions Daintree - Bloomfield
    IBRA 7 Regions Wet Tropics
    IBRA 7 Subregions Daintree-Bloomfield
    Terrestrial Ecoregional Boundaries Queensland Tropical Rain Forests
    World Anthropogenic Biomes (2000) Residential woodlands
    Climate
    Agroclimatic classification of Australia Moisture and temperature regime supports growth for 8���9 months of the year, with a 3���4 month dry season
    Koppen Climate Classification (All Classes) Tropical: rainforest (monsoonal)
    Koppen Climate Classification (Major Classes) Tropical
    Fire
    Fire regime niches Pasture (tropical and subtropical)
    Hydrology
    Drainage Divisions Level 1 North East Coast
    Drainage Divisions Level 2 MOSSMAN RIVER
    River Regions MOSSMAN RIVER
    Marine
    Marine Ecoregions of the World Central and Southern Great Barrier Reef
    States including coastal waters Queensland (including Coastal Waters)
    Political
    ASGS Australian States and Territories Queensland
    Australian States and Territories Queensland
    Commonwealth Electoral Boundaries Leichhardt
    Local Government Areas 2011 Cairns (R)
    Local Government Areas 2012 deprecated Douglas
    Local Government Areas PSMA 2018 DOUGLAS SHIRE
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 96
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 844
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF QLD
    PSMA ABS SA2 Statistical Areas (2016) DAINTREE
    PSMA ABS SA3 Statistical Areas (2016) PORT DOUGLAS - DAINTREE
    PSMA ABS SA4 Statistical Areas (2016) CAIRNS
    PSMA Commonwealth Electoral Boundaries (2016) LEICHHARDT
    PSMA Commonwealth Electoral Boundaries (2018) LEICHHARDT
    PSMA Indigenous Areas (2016) CAIRNS - FAR NORTH COAST
    PSMA Indigenous Locations (2016) MOSSMAN - SURROUNDS
    PSMA Indigenous Regions (2016) CAIRNS - ATHERTON
    PSMA Localities (2018) BONNIE DOON
    PSMA Remoteness Areas (2016) Outer Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (QLD)
    PSMA State Electoral Boundaries (2016) COOK
    PSMA State Electoral Boundaries (2018) COOK
    PSMA States (2016) QUEENSLAND
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (QLD)
    Statistical Local Areas Cairns (R) - Douglas
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Cairns Region
    Surface Geology of Australia Czs
    Topography
    Physiographic Provinces of Australia Peninsular Uplands Province
    Physiographic Regions 2011 Cairns Ranges
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Built-up
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Transformed
    Vegetation types - native Eucalypt open forests
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Beef numbers 48075.0 dse
    Dairy numbers 0.0 dse
    Dolomite (acidity) 3.0 t/ha
    Dolomite (physical) 0.0 t/ha
    Gypsum 1.0 t/ha
    Lime 1.0 t/ha
    Natural resource management expenditure 4148781.0 $
    Natural resource management expenditure - additional 2.0 $/ha
    Nitrogen 0.114905 t/ha
    Sheep numbers 65.0 dse
    Area management
    Phosphorus 0.029193 t/ha
    Potassium 0.134133 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.5241
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 4.7849
    Endemism 0.056058086
    Endemism (Non-marine) 0.0655601
    Mammals – Fritz et al 2009 - 0.5 degree 0.2691
    Migratory species (2008) 7.0 frequency
    Occurrence Density 16795.0 frequency
    Shannon Diversity (H) 6.594312 index
    Species Richness 2517.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 16.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.76949155
    2030A1BMk35M: Aridity index - month max 2.3828647
    2030A1BMk35M: Aridity index - month min 0.12921697
    2030A1BMk35M: Evaporation - annual mean 218.34334 mm
    2030A1BMk35M: Evaporation - month max 271.0 mm
    2030A1BMk35M: Evaporation - month min 176.67 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.5 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.26 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.45 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 74.08426 %
    2030A1BMk35M: Humidity - month max relative 3pm 78.30822 %
    2030A1BMk35M: Humidity - month min relative 3pm 69.13098 %
    2030A1BMk35M: Precipitation - annual mean 164.4 mm
    2030A1BMk35M: Precipitation - driest month 27.08 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.2946999
    2030A1BMk35M: Precipitation - max difference between successive months 6.994839 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -5.0502343 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 11.116203
    2030A1BMk35M: Precipitation - spring or autumn season -2.3805704
    2030A1BMk35M: Precipitation - summer or winter season 10.010738
    2030A1BMk35M: Precipitation - wettest month 466.97 mm
    2030A1BMk35M: Precipitation deficit - annual mean -53.943336 mm
    2030A1BMk35M: Precipitation deficit - month max -233.99 mm
    2030A1BMk35M: Precipitation deficit - month min 271.0 mm
    2030A1BMk35M: Radiation - max month precipitation modified 24.71 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 18.86 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 14.7 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 29.978333 degrees C
    2030A1BMk35M: Temperature - annual min mean 21.784166 degrees C
    2030A1BMk35M: Temperature - annual range 14.839996 degrees C
    2030A1BMk35M: Temperature - coldest month min 17.88 degrees C
    2030A1BMk35M: Temperature - coolest month max 26.38 degrees C
    2030A1BMk35M: Temperature - max difference in max 1.8500061 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 2.2000122 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 9.470001 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 8.194165 degrees C
    2030A1BMk35M: Temperature - min difference in max -1.6300049 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -2.0299988 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 7.2900085 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 32.72 degrees C
    2030A1BMk35M: Temperature - warmest month min 24.9 degrees C
    Aridity index - annual mean 1.0621213
    Aridity index - month max 3.0601368
    Aridity index - month min 0.18422821
    Evaporation - annual mean 172.60269 (ml/5km x 5km pixel)
    Evaporation - average 33737.0 ml
    Evaporation - month max 230.3925 mm
    Evaporation - month min 123.26543 mm
    Evaporation - variability 12.0 %
    Growth index C3 macrotherm plants - annual mean 0.54 index
    Growth index C3 mesotherm plants - annual mean 0.45 index
    Growth index C4 megatherm plants - annual mean 0.45 index
    Humidity - annual mean relative 80.40043 %
    Humidity - annual mean relative 3pm 73.10876 %
    Humidity - month max relative 84.61012 %
    Humidity - month max relative 3pm 77.04032 %
    Humidity - month min relative 67.97491 %
    Humidity - month min relative 3pm 67.97491 %
    Precipitation - annual 1773.0 mm
    Precipitation - annual (Bio12) 2088.0 mm
    Precipitation - annual (log) seasonality index 0.2311892
    Precipitation - annual mean 176.99226 mm
    Precipitation - annual seasonality 3.0440562
    Precipitation - annual seasonality ratio 4.0512958
    Precipitation - autumn 732.0 mm
    Precipitation - autumn reliability 44.0 %
    Precipitation - coldest quarter (Bio19) 108.0 mm
    Precipitation - driest month 30.0 mm
    Precipitation - driest period (Bio14) 7.0 mm
    Precipitation - driest quarter (Bio17) 98.0 mm
    Precipitation - equinox seasonality ratio 0.28593293
    Precipitation - max difference between successive months 7.655393 mm/day
    Precipitation - min difference between successive months -7.8231945 mm/day
    Precipitation - seasonality (Bio15) 90.0 mm
    Precipitation - solstice seasonality ratio 9.668343
    Precipitation - spring 205.0 mm
    Precipitation - spring or autumn (log) season -0.2350171
    Precipitation - spring or autumn season -2.48501
    Precipitation - spring reliability 35.0 %
    Precipitation - summer 1130.0 mm
    Precipitation - summer or winter (log) season 0.47650474
    Precipitation - summer or winter season 8.592974
    Precipitation - summer reliability 50.0 %
    Precipitation - warmest quarter (Bio18) 1025.0 mm
    Precipitation - wettest month 463.87354 mm
    Precipitation - wettest period (Bio13) 113.0 mm
    Precipitation - wettest quarter (Bio16) 1244.0 mm
    Precipitation - winter 118.0 mm
    Precipitation - winter reliability 32.0 %
    Precipitation deficit - annual mean 4.3895698 mm
    Precipitation deficit - month max -179.6415 mm
    Precipitation deficit - month min 312.28766 mm
    Radiation - annual mean (Bio20) 18.7 MJ/m2/day
    Radiation - coldest quarter (Bio27) 16.3 MJ/m2/day
    Radiation - driest quarter (Bio25) 17.3 MJ/m2/day
    Radiation - highest period (Bio21) 24.9 MJ/m2/day
    Radiation - lowest period (Bio22) 14.4 MJ/m2/day
    Radiation - max month precipitation modified 24.7 MJ/m2/day
    Radiation - mean annual precipitation modified 18.741667 MJ/m2/day
    Radiation - min month precipitation modified 14.5 MJ/m2/day
    Radiation - seasonality (Bio23) 16.0
    Radiation - warmest quarter (Bio26) 20.7 MJ/m2/day
    Radiation - wettest quarter (Bio24) 18.6 MJ/m2/day
    Temperature - annual max mean 28.095833 degrees C
    Temperature - annual mean (Bio01) 25.1 degrees C
    Temperature - annual min mean 20.065 degrees C
    Temperature - annual range 14.974915 degrees C
    Temperature - annual range (Bio07) 14.9 degrees C
    Temperature - coldest month min 16.14 degrees C
    Temperature - coldest period min (Bio06) 17.0 degrees C
    Temperature - coldest quarter mean (Bio11) 21.8 degrees C
    Temperature - coolest month max 24.54 degrees C
    Temperature - diurnal range mean (Bio02) 8.1 degrees C
    Temperature - driest quarter mean (Bio09) 22.2 degrees C
    Temperature - isothermality (Bio03) 0.55 %
    Temperature - max absolute mean max 38.0 degrees C
    Temperature - max difference in max 1.7099915 degrees C/day
    Temperature - max difference in min 2.1399841 degrees C/day
    Temperature - max month diurnal range 9.149994 degrees C
    Temperature - mean annual absolute mean min 11.4314165 degrees C
    Temperature - mean annual diurnal range 8.03083 degrees C
    Temperature - min absolute mean min 5.552 degrees C
    Temperature - min difference in max -1.6600037 degrees C/day
    Temperature - min difference in min -1.9499817 degrees C/day
    Temperature - min month diurnal range 7.0799866 degrees C
    Temperature - month hottest maximum 30.75 degrees C
    Temperature - month mean absolute max 34.710083 degrees C
    Temperature - seasonality (Bio04) 0.79
    Temperature - warmest month min 23.24 degrees C
    Temperature - warmest period max (Bio05) 31.9 degrees C
    Temperature - warmest quarter (Bio10) 27.7 degrees C
    Temperature - wettest quarter mean (Bio08) 27.4 degrees C
    Vapour pressure deficit - annual mean 0.4208045 KPa
    Vapour pressure deficit - annual mean 9am 0.49589226 KPa
    Vapour pressure deficit - month max 0.6831155 KPa
    Vapour pressure deficit - month max 9am 0.6831155 KPa
    Vapour pressure deficit - month min 0.23569107 KPa
    Vapour pressure deficit - month min 9am 0.3459611 KPa
    Wind run - annual mean 181.5984 km/day
    Wind run - month max 211.49211 km/day
    Wind run - month min 145.23325 km/day
    Wind speed - annual mean 3pm 4.5326457 m/s
    Wind speed - annual mean 9am 2.6146557 m/s
    Wind speed - annual mean 9am or 3pm 4.34905 m/s
    Wind speed - month max 3pm 5.3998017 m/s
    Wind speed - month max 9am 3.2982986 m/s
    Wind speed - month max 9am or 3pm 5.3998017 m/s
    Wind speed - month min 3pm 3.5993478 m/s
    Wind speed - month min 9am 1.8991493 m/s
    Wind speed - month min 9am or 3pm 1.8991493 m/s
    WorldClim: Precipitation - annual 2063.0 mm
    WorldClim: Precipitation - coldest quarter 99.0 mm
    WorldClim: Precipitation - driest month 26.0 mm
    WorldClim: Precipitation - driest quarter 88.0 mm
    WorldClim: Precipitation - seasonality 94.0
    WorldClim: Precipitation - warmest quarter 1059.0 mm
    WorldClim: Precipitation - wettest month 442.0 mm
    WorldClim: Precipitation - wettest quarter 1299.0 mm
    WorldClim: Temperature - annual mean 253.0 degrees C * 10
    WorldClim: Temperature - annual range 148.0 degrees C * 10
    WorldClim: Temperature - coldest month min 173.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 222.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 87.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 228.0 degrees C * 10
    WorldClim: Temperature - isothermality 58.0 %
    WorldClim: Temperature - seasonality 2161.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 321.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 276.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 274.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.04472136 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.058309518 km
    Euclidean Distance to Coast (metres) 6001.5337 m
    Remoteness index 3.94
    Hydrology
    Drainage - average 916.0 megalitres/5x5km/year
    Drainage - variability 119.0 %
    Runoff - average 14947.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Marine
    Great Barrier Reef 100m DEM 17.07 m
    SeaWIFS K490 Mean 0.13291512 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 1.4357588 mg/m^3
    Social
    Age 37.9 years
    Age - prime group 31.9 Count
    Disadvantaged 1036.05 points (mean=1000)
    Education - degrees 9.9 %
    Education - vocational training 29.3 %
    Employment 5.2 %
    Home ownership 45.8 %
    Income - high 29.0 %
    Income - low 14.1 %
    Internet 47.3 %
    Population - change 3.1 count
    Population - density SLA 2006 p/sqkm) 4.2 people/km^2
    Unemployment rate 1.7 %
    Work force - older 28.3 Count
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.5909913
    2030A1BMk35M: Crop factor - month max 0.90000004
    2030A1BMk35M: Crop factor - month min 0.12921697
    2030A1BMk35M: Water deficit - month max 98.12761 mm
    2030A1BMk35M: Water deficit - month mean 31.945377 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -0.88620543 MPa
    2030A1BMk35M: Water potential - month max -2.8643754E-14 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 53.189217
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 11.629526
    2030A1BMk35M: Water surplus - annual mean 40.039333 mm
    2030A1BMk35M: Water surplus - month max 283.71503 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 21.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.7 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 11.0 %
    Bouguer gravity anomalies 110.128 Gal
    Bulk density 1.075411 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic 1.360904 %
    Carbon store pre-European 138.4181 kgC/ha
    Clay % 36.482876 %
    Crop factor - annual mean 0.69487906
    Crop factor - month max 0.90000004
    Crop factor - month min 0.19161083
    Erodibility 66.0 k factor
    Erosional surfaces - proportion 100.0 %
    Erosivity 13368.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 100.0 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 65.5 my
    Lithology - fertility 6.0 index
    Lithology - mean age 32.75 my
    Lithology - mean age (log) 1.5152113 log my
    Lithology - mean age range (log) 1.8162413 log my
    Magnetic anomalies -38.0 nT
    Moisture - average 55.0 %
    Moisture - variability 10.0 %
    Moisture Index - annual mean (Bio28) 0.69
    Moisture Index - coldest quarter mean (Bio35) 0.52
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 1.0
    Moisture Index - lowest period (Bio30) 0.16
    Moisture Index - lowest quarter mean (Bio33) 0.22
    Moisture Index - seasonality (Bio31) 48.0
    Moisture Index - warmest quarter mean (Bio34) 0.89
    Nitrogen - plant-available pre-European 11689.52 kgN/ha
    Nitrogen concentration pre-European 50.9341 mgN kg/H2O
    Nitrogen store pre-European 175.5716 kgN/ha
    Nutrient status 1.95 index
    Pedality hydrological score 3.930822
    Ph - soil 4.0 ph
    Phosphorus - plant-available pre-European 32.2742 kgP/ha
    Phosphorus - plant-available total pre-European 1934.7711 kgP/ha
    Phosphorus pre-European 9.362889 mgP kg/H2O
    Soil depth 1.1 m
    Soil pedality 3.930822
    Soils - coarse 0.0 class
    Substrate data reliability 2.0
    Topographic wetness index 2.518373
    Unreliable water retention parameters 0.0
    Water deficit - month max 75.055885 mm
    Water deficit - month mean 19.449423 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 51000.0 mm
    Water holding capacity - plant-available 198.0 mm
    Water potential - annual mean -0.7329941 MPa
    Water potential - month max -2.8643754E-14 MPa
    Water potential - month min -1.5 MPa
    Water stress index - annual mean 62.539116
    Water stress index - month max 81.0
    Water stress index - month min 17.244974
    Water surplus - annual mean 62.81017 mm
    Water surplus - month max 327.44623 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 1.12383 Weathering Intensity Index
    Topography
    Aspect 52.0 degrees
    Averaged Topographic Relief 554.0833 metres
    Bathymetry and Topography 9 sec 42.0 m
    Elevation 13.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Slope length 1000.0 m
    Topographic Slope (degrees) 3.6509721 degrees
    Topographic relief 105.1038 m
    Topographic roughness 38.60004 %
    Topographic slope (%) 7.339709 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 0.0
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.4774 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 50.0 %
    Gross Primary Productivity (2012-03-13) 0.0018 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 1.3 m^2 plant / m^2 ground
    NDVI Mean 64.0 NDVI x 100
    NPP Mean 6.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.4867 NDVI
    Phenology peak day of year 2002 dry 52.692307 Day
    Phenology peak day of year 2012 wet 31.153847 Day