Occurrence record:

EnvironmentalDNA of Embellisia recorded on 2014-12-10

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated sequences https://www.ncbi.nlm.nih.gov/biosample/SAMN07488630
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2014-12-10
Date precision Day

Taxonomy

Scientific name Embellisia
Taxon rank genus
Kingdom Fungi
Phylum Ascomycota
Class Dothideomycetes
Order Pleosporales
Family Pleosporaceae
Genus Embellisia
Species Embellisia
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type wellformed

Geospatial

Country Australia
State / Province South Australia
Locality Yankalilla (DC)
Locality Fisheries Beach
Latitude -35.632738
Longitude 138.1164129
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial
Verbatim elevation 20.0

Additional properties

ammonium nitrogen mg kg 2.0
amplicon ITS1FITS4_fungi
australian soil classification Sodosols
boron hot cacl2 mg kg 0.9
broad land use Conservation and Natural Environments
clay 17.43
color BR
conductivity dsm ds m 0.174
course sand 16.02
depth m 0.0
detailed land use Conservation and Natural Environments - Nature conservation - Other conserved area
dtpa copper mg kg 0.94
dtpa iron mg kg 79.09
dtpa manganese mg kg 17.54
dtpa zinc mg kg 0.25
environment Soil
exc aluminium meq 100g 0.115
exc calcium meq 100g 3.82
exc magnesium meq 100g 1.43
exc potassium meq 100g 0.8
exc sodium meq 100g 0.8
fine sand 50.97
general ecological zone Coastal
gravel 5.0
ncbi bioproject accession PRJNA317932
ncbi biosample accession SAMN07488630
nitrate nitrogen mg kg 34.0
otu CACAATATGAAGGCGGGGATTGTGGACCTCCTTAGGAGTGACCTGGCCTGCTGAATTATTCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGCTCGCCCACCACCAGGACCAACCATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAATGTAATAATTA
otucount 1
organic carbon 1.25
ph level cacl2 cacl2 4.9
ph level h2o h2o 5.8
phosphorus colwell mg kg 6.0
potassium colwell mg kg 396.0
sample id 102.100.100/19269
sample type Soil
sand 66.99
silt 15.58
slope 8.0
soil moisture 10.13
sulphur mg kg 14.8
texture 2.0
vegetation type Woodland
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Altitude out of range Passed
    Altitude value non-numeric Passed
    Altitude value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 12 missing properties
    Show/Hide 45 tests that have not been run

    Additional political boundaries information

    Area Management
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Global 200 priority ecoregions - Terrestrial Southern Australia Mallee and Woodlands
    NRM Regions 2010 Adelaide and Mount Lofty Ranges
    NRM Regions 2014 Adelaide and Mount Lofty Ranges
    NRM Regions 2015 Adelaide and Mount Lofty Ranges
    NRM Regions 2017 Adelaide and Mount Lofty Ranges
    NRM Regions 2017 (Qld 2019) Adelaide and Mount Lofty Ranges
    Area management
    National Landcare Program Management Units 2018 Adelaide and Mount Lofty Ranges
    Biodiversity
    IBRA 6 Regions Kanmantoo
    IBRA 6 Sub Regions Fleurieu
    IBRA 7 Regions Kanmantoo
    IBRA 7 Subregions Fleurieu
    Terrestrial Ecoregional Boundaries Mount Lofty Woodlands
    World Anthropogenic Biomes (2000) Populated croplands
    Climate
    Agroclimatic classification of Australia Classic "Mediterranean" climate with peaks of growth in winter and spring and moderate growth in winter
    Koppen Climate Classification (All Classes) Temperate: distinctly dry (and warm) summer
    Koppen Climate Classification (Major Classes) Temperate
    Hydrology
    Drainage Divisions Level 1 South Australian Gulf
    Drainage Divisions Level 2 FLEURIEU PENINSULA
    River Regions FLEURIEU PENINSULA
    Marine
    Marine Ecoregions of the World Western Bassian
    States including coastal waters South Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories South Australia
    Australian States and Territories South Australia
    Commonwealth Electoral Boundaries Mayo
    Local Government Areas 2011 Yankalilla (DC)
    Local Government Areas 2012 deprecated Yankalilla
    Local Government Areas PSMA 2018 THE DC OF YANKALILLA
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 28
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 717
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF SA
    PSMA ABS SA2 Statistical Areas (2016) YANKALILLA
    PSMA ABS SA3 Statistical Areas (2016) FLEURIEU - KANGAROO ISLAND
    PSMA ABS SA4 Statistical Areas (2016) SOUTH AUSTRALIA - SOUTH EAST
    PSMA Commonwealth Electoral Boundaries (2016) MAYO
    PSMA Commonwealth Electoral Boundaries (2018) MAYO
    PSMA Indigenous Areas (2016) FLEURIEU - KANGAROO ISLAND
    PSMA Indigenous Locations (2016) FLEURIEU - KANGAROO ISLAND
    PSMA Indigenous Regions (2016) ADELAIDE
    PSMA Localities (2018) CAPE JERVIS
    PSMA Remoteness Areas (2016) Inner Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (SA)
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) LEGISLATIVE COUNCIL
    PSMA States (2016) SOUTH AUSTRALIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (SA)
    PSMA Wards (2018) FIELD WARD
    Statistical Local Areas Yankalilla (DC)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Kanmantoo Region
    Surface Geology of Australia -Cykk
    Topography
    Physiographic Provinces of Australia Gulfs Ranges Province
    Physiographic Regions 2011 Flinders-Lofty Ranges
    Vegetation
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Beef numbers 226953.0 dse
    Dairy numbers 203572.0 dse
    Natural resource management expenditure 7775071.0 $
    Nitrogen 381.31976 t/ha
    Sheep numbers 125927.0 dse
    Area management
    Phosphorus 381.28558 t/ha
    Potassium 381.31714 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.8556
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.8347
    Endemism 0.015186212
    Endemism (Non-marine) 0.017245036
    Mammals – Fritz et al 2009 - 0.5 degree 0.2691
    Migratory species (2008) 13.0 frequency
    Occurrence Density 45176.0 frequency
    Shannon Diversity (H) 5.337476 index
    Species Richness 2057.0 frequency
    Threatened species (2008) 7.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.52779114
    2030A1BMk35M: Aridity index - month max 1.5093236
    2030A1BMk35M: Aridity index - month min 0.063296504
    2030A1BMk35M: Evaporation - annual mean 127.35973 mm
    2030A1BMk35M: Evaporation - month max 218.86786 mm
    2030A1BMk35M: Evaporation - month min 54.93 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.05 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.2942857 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.03 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 76.81124 %
    2030A1BMk35M: Humidity - month max relative 3pm 84.779274 %
    2030A1BMk35M: Humidity - month min relative 3pm 68.77924 %
    2030A1BMk35M: Precipitation - annual mean 43.16256 mm
    2030A1BMk35M: Precipitation - driest month 13.853571 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.0852114
    2030A1BMk35M: Precipitation - max difference between successive months 0.9599309 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -0.62321967 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 0.21779115
    2030A1BMk35M: Precipitation - spring or autumn season 0.08447268
    2030A1BMk35M: Precipitation - summer or winter season -3.5211124
    2030A1BMk35M: Precipitation - wettest month 82.90714 mm
    2030A1BMk35M: Precipitation deficit - annual mean -84.197174 mm
    2030A1BMk35M: Precipitation deficit - month max -205.01428 mm
    2030A1BMk35M: Precipitation deficit - month min 27.977142 mm
    2030A1BMk35M: Radiation - max month precipitation modified 27.380714 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 17.057322 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 6.9014287 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 19.812857 degrees C
    2030A1BMk35M: Temperature - annual min mean 12.381965 degrees C
    2030A1BMk35M: Temperature - annual range 15.631409 degrees C
    2030A1BMk35M: Temperature - coldest month min 9.011429 degrees C
    2030A1BMk35M: Temperature - coolest month max 14.872143 degrees C
    2030A1BMk35M: Temperature - max difference in max 2.2807007 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 1.8028564 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 8.668549 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 7.4308877 degrees C
    2030A1BMk35M: Temperature - min difference in max -2.5485535 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -1.8250122 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 5.725006 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 24.642857 degrees C
    2030A1BMk35M: Temperature - warmest month min 16.19143 degrees C
    Precipitation - annual 535.0 mm
    Precipitation - annual (Bio12) 564.0 mm
    Precipitation - autumn 129.0 mm
    Precipitation - autumn reliability 43.0 %
    Precipitation - coldest quarter (Bio19) 245.0 mm
    Precipitation - driest period (Bio14) 4.0 mm
    Precipitation - driest quarter (Bio17) 55.333332 mm
    Precipitation - seasonality (Bio15) 56.0 mm
    Precipitation - spring 128.0 mm
    Precipitation - spring reliability 49.0 %
    Precipitation - summer 65.0 mm
    Precipitation - summer reliability 26.0 %
    Precipitation - warmest quarter (Bio18) 55.5 mm
    Precipitation - wettest period (Bio13) 21.666666 mm
    Precipitation - wettest quarter (Bio16) 252.0 mm
    Precipitation - winter 242.0 mm
    Precipitation - winter reliability 77.0 %
    Precipitation deficit - annual mean -87.21058 mm
    Precipitation deficit - month max -221.88779 mm
    Radiation - annual mean (Bio20) 16.916666 MJ/m2/day
    Radiation - coldest quarter (Bio27) 9.083334 MJ/m2/day
    Radiation - driest quarter (Bio25) 24.316668 MJ/m2/day
    Radiation - highest period (Bio21) 27.55 MJ/m2/day
    Radiation - lowest period (Bio22) 6.55 MJ/m2/day
    Radiation - seasonality (Bio23) 43.166668
    Radiation - warmest quarter (Bio26) 24.849998 MJ/m2/day
    Radiation - wettest quarter (Bio24) 8.166667 MJ/m2/day
    Temperature - annual mean (Bio01) 15.45 degrees C
    Temperature - annual range (Bio07) 15.866667 degrees C
    Temperature - coldest period min (Bio06) 8.266666 degrees C
    Temperature - coldest quarter mean (Bio11) 11.7 degrees C
    Temperature - diurnal range mean (Bio02) 7.366667 degrees C
    Temperature - driest quarter mean (Bio09) 19.216667 degrees C
    Temperature - isothermality (Bio03) 0.46333334 %
    Temperature - seasonality (Bio04) 1.0266666
    Temperature - warmest period max (Bio05) 24.1 degrees C
    Temperature - warmest quarter (Bio10) 19.233334 degrees C
    Temperature - wettest quarter mean (Bio08) 11.783333 degrees C
    Wind run - annual mean 356.48416 km/day
    Wind run - month max 393.04584 km/day
    Wind run - month min 325.98767 km/day
    Wind speed - annual mean 3pm 6.304238 m/s
    Wind speed - annual mean 9am 5.918373 m/s
    Wind speed - annual mean 9am or 3pm 6.4956794 m/s
    Wind speed - month max 3pm 6.6967597 m/s
    Wind speed - month max 9am 6.2945995 m/s
    Wind speed - month max 9am or 3pm 6.6967597 m/s
    Wind speed - month min 3pm 5.79514 m/s
    Wind speed - month min 9am 5.3940597 m/s
    Wind speed - month min 9am or 3pm 5.3940597 m/s
    WorldClim: Precipitation - annual 528.0 mm
    WorldClim: Precipitation - coldest quarter 232.0 mm
    WorldClim: Precipitation - driest month 14.0 mm
    WorldClim: Precipitation - driest quarter 49.0 mm
    WorldClim: Precipitation - seasonality 54.0
    WorldClim: Precipitation - warmest quarter 49.0 mm
    WorldClim: Precipitation - wettest month 82.0 mm
    WorldClim: Precipitation - wettest quarter 232.0 mm
    WorldClim: Temperature - annual mean 155.0 degrees C * 10
    WorldClim: Temperature - annual range 152.0 degrees C * 10
    WorldClim: Temperature - coldest month min 86.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 118.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 72.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 193.0 degrees C * 10
    WorldClim: Temperature - isothermality 47.0 %
    WorldClim: Temperature - seasonality 2946.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 238.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 193.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 118.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.089999996 degrees
    Distance - to coast 0.0 km x 100
    Distance - to non-permanent water (weighted) 0.089999996 degrees
    Distance - to permanent water (weighted) 0.17029385 km
    Euclidean Distance to Coast (metres) 1338.1715 m
    Remoteness index 3.7701728
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    GEOMACS - geometric mean 0.0 Pascals
    Sea Surface Temperature - MODIS Terra 16.83818 Degrees C
    SeaWIFS K490 Mean 0.09581159 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.7328368 mg/m^3
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.48225668
    2030A1BMk35M: Crop factor - month max 0.9
    2030A1BMk35M: Crop factor - month min 0.063296504
    2030A1BMk35M: Water deficit - month max 113.72305 mm
    2030A1BMk35M: Water deficit - month mean 50.2228 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -1.0383923 MPa
    2030A1BMk35M: Water potential - month max -2.8643754E-14 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 43.403103
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 5.6966853
    2030A1BMk35M: Water surplus - annual mean 0.38985157 mm
    2030A1BMk35M: Water surplus - month max 3.7516403 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 85.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.35 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 28.0 %
    Bouguer gravity anomalies 179.4042 Gal
    Bulk density 1.5384234 Mg/m^3
    Calcrete 0.0 presence
    Carbon store pre-European 106.2088 kgC/ha
    Clay % 50.61036 %
    Erodibility 7.0 k factor
    Erosional surfaces - proportion 6.25 %
    Erosivity 323.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 13.333333 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 47.25 my
    Lithology - fertility 3.076923 index
    Lithology - mean age 280.125 my
    Lithology - mean age (log) 2.118717 log my
    Lithology - mean age range (log) 1.6393197 log my
    Magnetic anomalies -195.0 nT
    Moisture Index - annual mean (Bio28) 0.5133333
    Moisture Index - coldest quarter mean (Bio35) 0.95166665
    Moisture Index - highest period (Bio29) 0.9916667
    Moisture Index - highest quarter mean (Bio32) 0.97333336
    Moisture Index - lowest period (Bio30) 0.068333335
    Moisture Index - lowest quarter mean (Bio33) 0.085
    Moisture Index - seasonality (Bio31) 73.5
    Moisture Index - warmest quarter mean (Bio34) 0.085
    Nitrogen - plant-available pre-European 9061.635 kgN/ha
    Nitrogen concentration pre-European 64.33063 mgN kg/H2O
    Nitrogen store pre-European 57.26656 kgN/ha
    Nutrient status 2.0 index
    Pedality hydrological score 3.8342342
    Phosphorus - plant-available pre-European 10.53843 kgP/ha
    Phosphorus - plant-available total pre-European 1130.1207 kgP/ha
    Phosphorus pre-European 11.83838 mgP kg/H2O
    Soil depth 1.2 m
    Soil pedality 3.8342342
    Soils - coarse 0.0 class
    Substrate data reliability 1.0
    Topographic wetness index 6.196142
    Unreliable water retention parameters 58.333332
    Water holding capacity 19250.0 mm
    Water holding capacity - plant-available 100.0 mm
    Weathering Intensity V2 4.02967 Weathering Intensity Index
    Topography
    Aspect 224.0 degrees
    Averaged Topographic Relief 274.29166 metres
    Bathymetry and Topography 9 sec 0.0 m
    Elevation 46.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Slope length 2130.0 m
    Topographic Slope (degrees) 2.6194782 degrees
    Topographic relief 29.35659 m
    Topographic roughness 93.39165 %
    Topographic slope (%) 5.611046 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 0.0
    Vegetation
    Fractional Cover - Bare Soil (2012-03-05) 58.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 30.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 13.0 % Persistent Vegetation
    NPP Mean 8.0 tonnes/ha/yr
    Phenology peak day of year 2002 dry 228.6923 Day
    Phenology peak day of year 2012 wet 217.0 Day