Occurrence record: BOLD - Australian records - 3496469

GenomicDNA of Ceramiales recorded on 2010-01-28

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3496469
Other catalogue numbers recordID:1367505;ProcessID:ABMMC8124-10;sampleID:GWS016317
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
Collector/Observer Saunders, G.W.|Dixon, K.
Supplied as "G.W. Saunders & K. Dixon"
License CC-BY-Int
Field number GWS016317
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Gerald T. Kraft

Event

Field number GWS016317
Record date 2010-01-28
Date precision Day

Taxonomy

Scientific name Ceramiales
Taxon rank order
Kingdom Plantae
Phylum Rhodophyta
Class Florideophyceae
Order Ceramiales
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Tasmania
Locality Sanctuary Reef, Wynyard
Latitude -40.986
Longitude 145.77
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Marine

Additional properties

genbank accession HM918152
markercode COI-5P
nucleotides TACTTTATATTTAATTTTTGGAGCTTTTTCTGGTGTTTTAGGAGGATGTATGTCAATGTTAATAAGAATGGAACTAGCTCAACCTGGTAATCATTTACTTTTAGGTAATCATCAAATTTATAATGTTTTAATAACAGCACATGCGTTTTTAATGATATTTTTTATGGTTATGCCTGTTATGATAGGAGGATTTGGAAATTGATTTGTACCTATAATGATAGGTAGTCCTGATATGGCATTTCCTCGTTTAAATAATATATCATTTTGGTTATTACCTCCTTCATTATGTTTGTTATTAATTTCATCAATTGTTGAAGTTGGAACAGGTACTGGTTGAACTGTATATCCACCATTAAGTTCAATTCAGAGTCATTCTGGTGCATCTGTAGATTTAGCAATATTTAGTTTACATTTATCAGGAGCATCTTCAATATTAGGTGCAATAAATTTTATTTCAACAATTTTAAATATGCGTAATCCTGGCCAAAGTTTATATAGAATACCTTTATTTGTATGATCAATTTTTGTAACTGCATTTTTATTATTATTAGCAGTACCAGTACTAGCAGGTGCAATTACAATGTTATTAACAGATCGTAATTTTAATACATCATTTTTTGATCCATCAGGTGGAGGAGATCCTGTTTTATATCAACATTTATTT
owner institution code University of New Brunswick, Fredericton
sequence last updated 2011-11-14T08:11:41Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Global 200 priority ecoregions - Marine Southern Australian Marine
    NRM Regions 2010 North West
    NRM Regions 2014 North West TAS
    NRM Regions 2015 North West
    NRM Regions 2017 North West NRM Region
    NRM Regions 2017 (Qld 2019) North West NRM Region
    Area management
    National Landcare Program Management Units 2018 North West NRM Region
    Biodiversity
    IMCRA 4 Regions Bass Strait Shelf Province
    IMCRA Meso-scale Bioregions Boags
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Marine
    FAO Fishery Statistical Areas 57
    Geomorphology of the Australian Margin and adjacent seafloor Plateau
    Global Seagrass Species Richness (2003) 4.00000000
    Marine Ecoregions of the World Bassian
    States including coastal waters Tasmania (including Coastal Waters)
    Territorial Sea Territorial Sea

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.5103
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.2931
    Endemism 0.017055089
    Endemism (Non-marine) 0.020528968
    Mammals – Fritz et al 2009 - 0.5 degree 0.4126
    Occurrence Density 22314.0 frequency
    Shannon Diversity (H) 5.013095 index
    Species Richness 1210.0 frequency
    Distance
    Euclidean Distance to Coast (metres) 1798.3705 m
    Marspec Distance to Shore 2.0 km
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    GEOMACS - geometric mean 0.019831 Pascals
    Marspec Annual Range in Sea Surface Salinity 0.29 100 x psu
    Marspec Annual Range in Sea Surface Temperature 6.74 100 x degrees C
    Marspec Annual Variance in Sea Surface Salinity 0.71999997 100 x psu
    Marspec Annual Variance in Sea Surface Temperature 5.7809997 10,000 x degrees C
    Marspec Bathymetric Slope 0.3 10 x degrees
    Marspec Concavity -0.031000001 1000 x degrees
    Marspec East/West Aspect 0.25 radians
    Marspec Maximum Monthly Sea Surface Salinity 35.5 100 x psu
    Marspec Mean Annual Sea Surface Salinity 35.34 100 x psu
    Marspec Mean Annual Sea Surface Temperature 14.44 100 x degrees C
    Marspec Minimum Monthly Sea Surface Salinity 35.21 100 x psu
    Marspec North/South Aspect 0.96999997 1 x radians
    Marspec Plan Curvature -0.0019999999 x 10000
    Marspec Profile Curvature 0.0011 x 10000
    Marspec Sea Surface Temperature of the coldest ice-free month 11.469999 100 x degrees C
    Marspec Sea Surface Temperature of the warmest ice-free month 18.21 100 x degrees C
    Sea Surface Temperature - MODIS Terra 14.728699 Degrees C
    SeaWIFS K490 Mean 0.10535365 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.9362551 mg/m^3
    Topography
    Averaged Topographic Relief 164.375 metres
    Bathymetry and Elvation 9 sec -11.0 m
    Topographic Slope (degrees) 0.55271566 degrees