Occurrence record: BOLD - Australian records - 3364322

GenomicDNA of PLEURONECTIFORMES | Flatfishes recorded on 2005-02-23

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3364322
Other catalog numbers recordID:849708;ProcessID:FOAH251-08;sampleID:BW-A5162
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
Collector/Observer D. Gledhill (CSIRO)
License CC-BY-Int
Field number CMR002845b
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Thomas Munroe

Event

Field number CMR002845b
Record date 2005-02-23
Date precision Day

Taxonomy

Scientific name PLEURONECTIFORMES
Taxon rank order
Common name Flatfishes
Kingdom Animalia
Phylum Chordata
Class Actinopterygii
Order Pleuronectiformes
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province Queensland
Locality Off Mackay, Southern GBR
Latitude -21.299
Longitude 149.57
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Marine

Additional properties

genbank accession GU673177
markercode COI-5P
nucleotides CCTATACATAGTATTTGGTGCCTGAGCCGGAATAGTAGGAACTGCTTTAAGCCTACTTATTCGAGCAGAACTAAGCCAACCCGGCAGCTTGCTTGGCGATGACCAAATTTATAATGTTATCGTTACTGCCCATGCATTTGTTATAATTTTCTTTATAGTAATACCTATTATGATTGGGGGCTTCGGAAATTGATTAATTCCCCTTATGATTGGAGCGCCTGACATGGCCTTCCCCCGAATAAATAATATAAGCTTCTGACTTCTCCCACCATCTTTTATTCTTCTATTGGCCTCGTCTGCAGTAGAAGCTGGGGCCGGGACGGGTTGAACCGTTTATCCTCCGTTAGCGGGTAATCTTGCCCACGCAGGTGCATCCGTAGACTTAACAATTTTCTCCCTACACTTAGCGGGAGTCTCATCCATTTTAGGTGCTATTAACTTTATTACCACCATTCTAAACATAAAACCTGAGGGCATGACTATGTATCAAATACCACTATTTGTTTGAGCAGTATTTATTACAGCTATTCTCCTCCTCCTCTCCCTGCCCGTTCTAGCAGCCGGTATTACTATACTCCTAACGGACCGAAACTTAAATACTACTTTCTTTGACCCCGCCGGAGGGGGTGACCCAATTCTTTATCAACATCTCTTC
Owner institution code Biodiversity Institute of Ontario
sequence last updated 2011-11-14T08:11:16Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Coral Ecoregions Keppel Islands & Capricorn Bunker Reefs, Souther GBR
    Australian Tropical Savanna Australian Tropical Savanna
    CAPAD 2010 Marine Great Barrier Reef
    CAPAD 2012 Marine Great Barrier Reef
    CAPAD 2014 Marine Great Barrier Reef
    CAPAD 2016 Marine Great Barrier Reef
    Directory of Important Wetlands Great Barrier Reef Marine Park
    Global 200 priority ecoregions - Marine Great Barrier Reef
    NRM Regions 2010 Mackay Whitsunday
    NRM Regions 2014 Mackay Whitsunday
    NRM Regions 2015 Mackay Whitsunday
    NRM Regions 2017 Mackay Whitsunday
    NRM Regions 2017 (Qld 2019) Mackay Whitsunday
    Area management
    National Landcare Program Management Units 2018 Mackay Whitsunday
    Biodiversity
    IMCRA 4 Regions Northeast Shelf Province
    IMCRA Meso-scale Bioregions Shoalwater Coast
    Marine
    FAO Fishery Statistical Areas 71
    Geomorphology of the Australian Margin and adjacent seafloor Shelf
    Global Seagrass Species Richness (2003) 11.00000000
    Marine Ecoregions of the World Central and Southern Great Barrier Reef
    States including coastal waters Queensland (including Coastal Waters)
    Political
    Local Government Areas PSMA 2018 MACKAY REGIONAL
    PSMA Localities (2018) CORAL SEA
    PSMA State Electoral Boundaries (2016) MIRANI
    PSMA State Electoral Boundaries (2018) MIRANI

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.2506
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 0.0
    Endemism 0.009276922
    Endemism (Non-marine) 0.016156476
    Mammals – Fritz et al 2009 - 0.5 degree 0.2691
    Occurrence Density 169.0 frequency
    Shannon Diversity (H) 4.5383086 index
    Species Richness 106.0 frequency
    Distance
    Euclidean Distance to Coast (metres) 23845.66 m
    Marspec Distance to Shore 11.0 km
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    GEOMACS - geometric mean 0.123215 Pascals
    Great Barrier Reef 100m DEM -22.06219 m
    Marspec Annual Range in Sea Surface Salinity 0.68 100 x psu
    Marspec Annual Range in Sea Surface Temperature 7.7599998 100 x degrees C
    Marspec Annual Variance in Sea Surface Salinity 6.2799997 100 x psu
    Marspec Annual Variance in Sea Surface Temperature 7.1580997 10,000 x degrees C
    Marspec Bathymetric Slope 0.0 10 x degrees
    Marspec Concavity 0.002 1000 x degrees
    Marspec East/West Aspect 0.85999995 radians
    Marspec Maximum Monthly Sea Surface Salinity 35.63 100 x psu
    Marspec Mean Annual Sea Surface Salinity 35.28 100 x psu
    Marspec Mean Annual Sea Surface Temperature 24.66 100 x degrees C
    Marspec Minimum Monthly Sea Surface Salinity 34.95 100 x psu
    Marspec North/South Aspect 0.51 1 x radians
    Marspec Plan Curvature 1.0E-4 x 10000
    Marspec Profile Curvature -1.0E-4 x 10000
    Marspec Sea Surface Temperature of the coldest ice-free month 20.46 100 x degrees C
    Marspec Sea Surface Temperature of the warmest ice-free month 28.22 100 x degrees C
    Sea Surface Temperature - MODIS Terra 24.862284 Degrees C
    SeaWIFS K490 Mean 0.07630933 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.523243 mg/m^3
    Topography
    Averaged Topographic Relief 7.3333335 metres
    Bathymetry and Topography 9 sec -17.0 m
    Topographic Slope (degrees) 0.026914014 degrees