Occurrence record:

EnvironmentalDNA of Fungi recorded on 2014-10-15

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated sequences https://www.ncbi.nlm.nih.gov/biosample/SAMN07483679
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2014-10-15
Date precision Day

Taxonomy

Scientific name Fungi
Taxon rank kingdom
Kingdom Fungi
Phylum Fungi unclassified
Class Fungi unclassified
Order Fungi unclassified
Family Fungi unclassified
Genus Fungi unclassified
Species Fungi unclassified
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type wellformed

Geospatial

Country Australia
State / Province Tasmania
Locality Southern Midlands (M)
Locality jerico_sheltbelt
Latitude -42.38459
Longitude 147.31059
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

ammonium nitrogen mg kg 13.0
amplicon ITS1FITS4_fungi
boron hot cacl2 mg kg 0.45
clay 13.62
color GRBR
conductivity dsm ds m 0.074
course sand 38.08
depth m 0.0
dtpa copper mg kg 1.18
dtpa iron mg kg 260.93
dtpa manganese mg kg 70.33
dtpa zinc mg kg 2.34
environment Soil
exc aluminium meq 100g 0.143
exc calcium meq 100g 6.14
exc magnesium meq 100g 1.63
exc potassium meq 100g 0.64
exc sodium meq 100g 0.15
fine sand 35.68
gravel 0.0
ncbi bioproject accession PRJNA317932
ncbi biosample accession SAMN07483679
nitrate nitrogen mg kg 5.0
otu CAAAATGATGGTTTTTTGGCTTGAGCTGCTTTCGAGTGGCTCGCTAAAAGACTTATTCACCCTTGTGCATCGTAATGTTTTTTGGGTCGGTTTTACGACTGGCCCAGCATTTATAAACACCTTTTTTAATTTGACTGAATTTTTTTGAAAAATAAAAAATAA
otucount 57
organic carbon 2.97
ph level cacl2 cacl2 4.6
ph level h2o h2o 5.4
phosphorus colwell mg kg 35.0
potassium colwell mg kg 268.0
sample id 102.100.100/15943
sample type Soil
sand 73.76
silt 12.62
soil moisture 8.0929487179487
sulphur mg kg 8.0
texture 2.0
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 12 missing properties
    Show/Hide 48 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) Fallow less than 3 months
    Fallow practice - dominant (number) Fallow less than 3 months
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Global 200 priority ecoregions - Terrestrial Tasmanian Temperate Rainforests
    Irrigation practice - dominant 6. Local knowledge
    Land use Modified pastures
    NRM Regions 2010 South
    NRM Regions 2014 South
    NRM Regions 2015 South
    NRM Regions 2017 South NRM Region
    NRM Regions 2017 (Qld 2019) South NRM Region
    Stubble practice - dominant (area) Stubble ploughed in
    Stubble practice - dominant (number) Stubble ploughed in
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 South NRM Region
    Biodiversity
    Freshwater Ecoregions of the World Southern Tasmania
    IBRA 6 Regions Tasmanian South East
    IBRA 6 Sub Regions South East
    IBRA 7 Regions Tasmanian South East
    IBRA 7 Subregions South East
    Terrestrial Ecoregional Boundaries Tasmanian Temperate Forests
    World Anthropogenic Biomes (2000) Populated croplands
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Koppen Climate Classification (All Classes) Temperate: no dry season (mild summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Pasture, cropland (temperate)
    Hydrology
    Drainage Divisions Level 1 Tasmania
    Drainage Divisions Level 2 DERWENT RIVER
    River Regions DERWENT RIVER
    Marine
    Marine Ecoregions of the World Bassian
    States including coastal waters Tasmania (including Coastal Waters)
    Political
    ASGS Australian States and Territories Tasmania
    Australian States and Territories Tasmania
    Commonwealth Electoral Boundaries Lyons
    Local Government Areas 2011 Southern Midlands (M)
    Local Government Areas 2012 deprecated Southern Midlands
    Local Government Areas PSMA 2018 SOUTHERN MIDLANDS COUNCIL
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 3
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 1233
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF TAS.
    PSMA ABS SA2 Statistical Areas (2016) SOUTHERN MIDLANDS
    PSMA ABS SA3 Statistical Areas (2016) CENTRAL HIGHLANDS (TAS.)
    PSMA ABS SA4 Statistical Areas (2016) SOUTH EAST
    PSMA Commonwealth Electoral Boundaries (2016) LYONS
    PSMA Commonwealth Electoral Boundaries (2018) LYONS
    PSMA Indigenous Areas (2016) CENTRAL TASMANIA
    PSMA Indigenous Locations (2016) SOUTHERN MIDLANDS
    PSMA Indigenous Regions (2016) TASMANIA
    PSMA Localities (2018) JERICHO
    PSMA Remoteness Areas (2016) Outer Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (TAS.)
    PSMA State Electoral Boundaries (2016) LYONS
    PSMA State Electoral Boundaries (2018) PROSSER
    PSMA States (2016) TASMANIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (TAS.)
    Statistical Local Areas Southern Midlands (M)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Central Tasmania Region
    Surface Geology of Australia Jdtm
    Topography
    Physiographic Provinces of Australia Tasmanian Uplands Province
    Physiographic Regions 2011 East Tasmanian Hills
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Annual crops and highly modified pastures
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Replaced
    Vegetation types - native Eucalypt open forests
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Beef numbers 208154.0 dse
    Dairy numbers 9883.0 dse
    Dolomite (acidity) 2.0 t/ha
    Dolomite (physical) 2.0 t/ha
    Lime 1.0 t/ha
    Natural resource management expenditure 3022633.0 $
    Natural resource management expenditure - additional 2.0 $/ha
    Nitrogen 0.056195 t/ha
    Sheep numbers 730511.0 dse
    Area management
    Phosphorus 0.019187 t/ha
    Potassium 0.098508 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.4795
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.6747
    Endemism 0.009399462
    Endemism (Non-marine) 0.010604731
    Mammals – Fritz et al 2009 - 0.5 degree 0.2867
    Migratory species (2008) 4.0 frequency
    Occurrence Density 10862.0 frequency
    Shannon Diversity (H) 5.1819 index
    Species Richness 932.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 8.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.5292084
    2030A1BMk35M: Aridity index - month max 1.0042173
    2030A1BMk35M: Aridity index - month min 0.1895319
    2030A1BMk35M: Evaporation - annual mean 99.12458 mm
    2030A1BMk35M: Evaporation - month max 177.19 mm
    2030A1BMk35M: Evaporation - month min 40.31 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.01 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.15 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.01 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 75.72854 %
    2030A1BMk35M: Humidity - month max relative 3pm 88.06147 %
    2030A1BMk35M: Humidity - month min relative 3pm 62.851864 %
    2030A1BMk35M: Precipitation - annual mean 40.384167 mm
    2030A1BMk35M: Precipitation - driest month 28.1 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.1971304
    2030A1BMk35M: Precipitation - max difference between successive months 0.2552366 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -0.49660003 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 0.9512585
    2030A1BMk35M: Precipitation - spring or autumn season 0.19534512
    2030A1BMk35M: Precipitation - summer or winter season -0.050812148
    2030A1BMk35M: Precipitation - wettest month 48.45 mm
    2030A1BMk35M: Precipitation deficit - annual mean -58.740417 mm
    2030A1BMk35M: Precipitation deficit - month max -130.96 mm
    2030A1BMk35M: Precipitation deficit - month min 0.16999817 mm
    2030A1BMk35M: Radiation - max month precipitation modified 23.4 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 14.209167 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 5.21 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 16.568333 degrees C
    2030A1BMk35M: Temperature - annual min mean 5.6075 degrees C
    2030A1BMk35M: Temperature - annual range 21.070007 degrees C
    2030A1BMk35M: Temperature - coldest month min 1.78 degrees C
    2030A1BMk35M: Temperature - coolest month max 10.45 degrees C
    2030A1BMk35M: Temperature - max difference in max 2.5900269 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 1.6300049 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 13.380005 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 10.960838 degrees C
    2030A1BMk35M: Temperature - min difference in max -3.3200073 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -1.9899902 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 8.670013 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 22.85 degrees C
    2030A1BMk35M: Temperature - warmest month min 9.48 degrees C
    Aridity index - annual mean 0.8579498
    Aridity index - month max 2.1755478
    Aridity index - month min 0.26849616
    Evaporation - annual mean 80.80967 (ml/5km x 5km pixel)
    Evaporation - average 10210.0 ml
    Evaporation - month max 156.42682 mm
    Evaporation - month min 20.918678 mm
    Evaporation - variability 5.0 %
    Growth index C3 macrotherm plants - annual mean 0.01 index
    Growth index C3 mesotherm plants - annual mean 0.16 index
    Growth index C4 megatherm plants - annual mean 0.01 index
    Humidity - annual mean relative 84.07433 %
    Humidity - annual mean relative 3pm 74.885315 %
    Humidity - month max relative 94.62247 %
    Humidity - month max relative 3pm 86.97869 %
    Humidity - month min relative 61.872883 %
    Humidity - month min relative 3pm 61.872883 %
    Precipitation - annual 528.0 mm
    Precipitation - annual (Bio12) 523.0 mm
    Precipitation - annual (log) seasonality index 0.011511259
    Precipitation - annual mean 46.39033 mm
    Precipitation - annual seasonality 0.06658234
    Precipitation - annual seasonality ratio 1.0668296
    Precipitation - autumn 129.0 mm
    Precipitation - autumn reliability 49.0 %
    Precipitation - coldest quarter (Bio19) 129.0 mm
    Precipitation - driest month 38.509586 mm
    Precipitation - driest period (Bio14) 7.0 mm
    Precipitation - driest quarter (Bio17) 111.0 mm
    Precipitation - equinox seasonality ratio 1.1179568
    Precipitation - max difference between successive months 0.4261158 mm/day
    Precipitation - min difference between successive months -0.56482536 mm/day
    Precipitation - seasonality (Bio15) 15.0 mm
    Precipitation - solstice seasonality ratio 1.0107589
    Precipitation - spring 145.0 mm
    Precipitation - spring or autumn (log) season 0.022661103
    Precipitation - spring or autumn season 0.117065355
    Precipitation - spring reliability 56.0 %
    Precipitation - summer 138.0 mm
    Precipitation - summer or winter (log) season 0.0021515929
    Precipitation - summer or winter season 0.010681795
    Precipitation - summer reliability 41.0 %
    Precipitation - warmest quarter (Bio18) 127.0 mm
    Precipitation - wettest month 59.509586 mm
    Precipitation - wettest period (Bio13) 12.0 mm
    Precipitation - wettest quarter (Bio16) 152.0 mm
    Precipitation - winter 137.0 mm
    Precipitation - winter reliability 55.0 %
    Precipitation deficit - annual mean -34.419342 mm
    Precipitation deficit - month max -114.42682 mm
    Precipitation deficit - month min 24.590908 mm
    Radiation - annual mean (Bio20) 14.1 MJ/m2/day
    Radiation - coldest quarter (Bio27) 6.5 MJ/m2/day
    Radiation - driest quarter (Bio25) 6.2 MJ/m2/day
    Radiation - highest period (Bio21) 23.6 MJ/m2/day
    Radiation - lowest period (Bio22) 4.9 MJ/m2/day
    Radiation - max month precipitation modified 23.5 MJ/m2/day
    Radiation - mean annual precipitation modified 14.005643 MJ/m2/day
    Radiation - min month precipitation modified 5.1 MJ/m2/day
    Radiation - seasonality (Bio23) 47.0
    Radiation - warmest quarter (Bio26) 21.8 MJ/m2/day
    Radiation - wettest quarter (Bio24) 20.3 MJ/m2/day
    Temperature - annual max mean 14.969167 degrees C
    Temperature - annual mean (Bio01) 10.2 degrees C
    Temperature - annual min mean 4.1116667 degrees C
    Temperature - annual range 20.28946 degrees C
    Temperature - annual range (Bio07) 21.2 degrees C
    Temperature - coldest month min 0.35 degrees C
    Temperature - coldest period min (Bio06) 0.9 degrees C
    Temperature - coldest quarter mean (Bio11) 5.8 degrees C
    Temperature - coolest month max 8.8 degrees C
    Temperature - diurnal range mean (Bio02) 10.8 degrees C
    Temperature - driest quarter mean (Bio09) 6.8 degrees C
    Temperature - isothermality (Bio03) 0.51 %
    Temperature - max absolute mean max 36.0 degrees C
    Temperature - max difference in max 2.539978 degrees C/day
    Temperature - max difference in min 1.7200012 degrees C/day
    Temperature - max month diurnal range 13.26001 degrees C
    Temperature - mean annual absolute mean min -4.5960307 degrees C
    Temperature - mean annual diurnal range 10.857503 degrees C
    Temperature - min absolute mean min -11.053344 degrees C
    Temperature - min difference in max -3.6399841 degrees C/day
    Temperature - min difference in min -2.1900024 degrees C/day
    Temperature - min month diurnal range 8.450012 degrees C
    Temperature - month hottest maximum 21.08 degrees C
    Temperature - month mean absolute max 30.10701 degrees C
    Temperature - seasonality (Bio04) 1.23
    Temperature - warmest month min 7.83 degrees C
    Temperature - warmest period max (Bio05) 22.1 degrees C
    Temperature - warmest quarter (Bio10) 14.7 degrees C
    Temperature - wettest quarter mean (Bio08) 11.8 degrees C
    Vapour pressure deficit - annual mean 0.08061096 KPa
    Vapour pressure deficit - annual mean 9am 0.250005 KPa
    Vapour pressure deficit - month max 0.47878098 KPa
    Vapour pressure deficit - month max 9am 0.47878098 KPa
    Vapour pressure deficit - month min 0.0 KPa
    Vapour pressure deficit - month min 9am 0.11941028 KPa
    Wind run - annual mean 145.1933 km/day
    Wind run - month max 178.37447 km/day
    Wind run - month min 118.80515 km/day
    Wind speed - annual mean 3pm 3.1333334 m/s
    Wind speed - annual mean 9am 2.1083333 m/s
    Wind speed - annual mean 9am or 3pm 3.45 m/s
    Wind speed - month max 3pm 3.9 m/s
    Wind speed - month max 9am 3.0 m/s
    Wind speed - month max 9am or 3pm 3.9 m/s
    Wind speed - month min 3pm 2.4 m/s
    Wind speed - month min 9am 1.5 m/s
    Wind speed - month min 9am or 3pm 1.5 m/s
    WorldClim: Precipitation - annual 553.0 mm
    WorldClim: Precipitation - coldest quarter 145.0 mm
    WorldClim: Precipitation - driest month 35.0 mm
    WorldClim: Precipitation - driest quarter 117.0 mm
    WorldClim: Precipitation - seasonality 12.0
    WorldClim: Precipitation - warmest quarter 127.0 mm
    WorldClim: Precipitation - wettest month 54.0 mm
    WorldClim: Precipitation - wettest quarter 156.0 mm
    WorldClim: Temperature - annual mean 100.0 degrees C * 10
    WorldClim: Temperature - annual range 202.0 degrees C * 10
    WorldClim: Temperature - coldest month min 10.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 55.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 103.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 143.0 degrees C * 10
    WorldClim: Temperature - isothermality 50.0 %
    WorldClim: Temperature - seasonality 3424.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 212.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 143.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 114.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.4365776 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.031622775 km
    Euclidean Distance to Coast (metres) 26489.0 m
    Remoteness index 4.8817635
    Hydrology
    Drainage - average 1590.0 megalitres/5x5km/year
    Drainage - variability 87.0 %
    Runoff - average 0.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Age 39.8 years
    Age - prime group 25.0 Count
    Disadvantaged 948.515 points (mean=1000)
    Education - degrees 5.2 %
    Education - vocational training 20.7 %
    Employment 20.2 %
    Home ownership 76.9 %
    Income - high 22.1 %
    Income - low 17.0 %
    Internet 43.9 %
    Population - change 2.8 count
    Population - density SLA 2006 p/sqkm) 2.2 people/km^2
    Unemployment rate 3.9 %
    Work force - older 30.2 Count
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.51505107
    2030A1BMk35M: Crop factor - month max 0.8689452
    2030A1BMk35M: Crop factor - month min 0.1895319
    2030A1BMk35M: Water deficit - month max 96.99895 mm
    2030A1BMk35M: Water deficit - month mean 36.80845 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -1.3444111 MPa
    2030A1BMk35M: Water potential - month max -0.7064648 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 46.354595
    2030A1BMk35M: Water stress index - month max 78.20506
    2030A1BMk35M: Water stress index - month min 17.05787
    2030A1BMk35M: Water surplus - annual mean 0.0 mm
    2030A1BMk35M: Water surplus - month max 0.0 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 62.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.17 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 24.0 %
    Bouguer gravity anomalies -141.9363 Gal
    Bulk density 1.5842391 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic 2.3953943 %
    Carbon store pre-European 214.4524 kgC/ha
    Clay % 44.491848 %
    Crop factor - annual mean 0.6864817
    Crop factor - month max 0.90000004
    Crop factor - month min 0.26849616
    Erodibility 46.0 k factor
    Erosional surfaces - proportion 100.0 %
    Erosivity 733.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 11.1 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 54.1 my
    Lithology - fertility 10.0 index
    Lithology - mean age 172.55 my
    Lithology - mean age (log) 2.2369149 log my
    Lithology - mean age range (log) 1.7331972 log my
    Magnetic anomalies -159.0 nT
    Moisture - average 49.0 %
    Moisture - variability 6.0 %
    Moisture Index - annual mean (Bio28) 0.63
    Moisture Index - coldest quarter mean (Bio35) 0.83
    Moisture Index - highest period (Bio29) 0.94
    Moisture Index - highest quarter mean (Bio32) 0.92
    Moisture Index - lowest period (Bio30) 0.23
    Moisture Index - lowest quarter mean (Bio33) 0.3
    Moisture Index - seasonality (Bio31) 39.0
    Moisture Index - warmest quarter mean (Bio34) 0.32
    Nitrogen - plant-available pre-European 18436.77 kgN/ha
    Nitrogen concentration pre-European 71.84306 mgN kg/H2O
    Nitrogen store pre-European 80.35031 kgN/ha
    Nutrient status 1.15 index
    Pedality hydrological score 3.5451088
    Ph - soil 5.0 ph
    Phosphorus - plant-available pre-European 14.81544 kgP/ha
    Phosphorus - plant-available total pre-European 2128.2065 kgP/ha
    Phosphorus pre-European 13.24682 mgP kg/H2O
    Soil depth 1.0 m
    Soil pedality 3.5451088
    Soils - coarse 0.0 class
    Substrate data reliability 1.0
    Topographic wetness index 6.82053
    Unreliable water retention parameters 59.5
    Water deficit - month max 80.58633 mm
    Water deficit - month mean 21.021748 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 40000.0 mm
    Water holding capacity - plant-available 85.0 mm
    Water potential - annual mean -0.8592821 MPa
    Water potential - month max -0.0026000226 MPa
    Water potential - month min -1.5 MPa
    Water stress index - annual mean 61.78335
    Water stress index - month max 81.0
    Water stress index - month min 24.164654
    Water surplus - annual mean 0.0 mm
    Water surplus - month max 0.0 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 3.86638 Weathering Intensity Index
    Topography
    Aspect 294.0 degrees
    Averaged Topographic Relief 193.25 metres
    Bathymetry and Topography 9 sec 404.0 m
    Elevation 401.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Slope length 2321.0 m
    Topographic Slope (degrees) 2.8018177 degrees
    Topographic relief 37.53931 m
    Topographic roughness 2.22068 %
    Topographic slope (%) 2.559442 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 0.0
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3098 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 24.0 %
    Fractional Cover - Bare Soil (2012-03-05) 2.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 59.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 39.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0248 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.5 m^2 plant / m^2 ground
    NDVI Mean 61.0 NDVI x 100
    NPP Mean 5.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.4701 NDVI
    Phenology peak day of year 2002 dry 275.66666 Day
    Phenology peak day of year 2012 wet 278.33334 Day