Occurrence record: BOLD - Australian records - 3749761

GenomicDNA of LEPIDOPTERA | Moths recorded on 1989-07-05

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3749761
Other catalog numbers recordID:1650732;ProcessID:ANICJ048-10;sampleID:10ANIC-06045
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Nielsen|Edwards|Horak
Supplied as "Nielsen, Edwards, Horak"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 1989-07-05
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province Queensland
Locality Cook (S)
Locality Mango Tree
Latitude -13.45
Longitude 143.22
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HQ949390
markercode COI-5P
nucleotides AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCATTAAGATTACTAATTCGTGCTGAATTAGGAAATCCAGGTTCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGATTAATTCCATTAATATTAGGAGCTCCAGATATAGCATTCCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCCCCTTCTTTAACTTTATTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCTCATGGAGGAAGTTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGCTGGTATTTCTTCAATTTTAGGAGCAATTAATTTTATTTCTACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACTGCATTTTTACTTCTTCTTTCATTACCAGTATTAGCTGGAGCTATTACTATACTTCTTACTGATCGAAATTTAAATACATCTTTTTTTGATCCAGCAGGTGGTGGTGATCCAATTTTATATCAACATTTATTT
Owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:43Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Tropical Savanna Australian Tropical Savanna
    Fallow practice - dominant (area) Fallow greater than 9 months
    Fallow practice - dominant (number) Fallow greater than 9 months
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Northern Australia and Trans-Fly Savannas
    Important Bird Areas (IBA) Australia Iron & McIlwraith Ranges IBA
    Irrigation practice - dominant 6. Local knowledge
    Land use Grazing of native pastures
    NRM Regions 2010 Cape York
    NRM Regions 2014 Cape York
    NRM Regions 2015 Cape York
    NRM Regions 2017 Cape York
    NRM Regions 2017 (Qld 2019) Cape York
    Stubble practice - dominant (area) Stubble ploughed in
    Stubble practice - dominant (number) Stubble ploughed in
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 Cape York
    Biodiversity
    Freshwater Ecoregions of the World Arafura - Carpentaria
    IBRA 6 Regions Cape York Peninsula
    IBRA 6 Sub Regions Coen - Yambo Inlier
    IBRA 7 Regions Cape York Peninsula
    IBRA 7 Subregions Coen-Yambo Inlier
    Terrestrial Ecoregional Boundaries Cape York Peninsula Tropical Savanna
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Moisture and temperature regime supports growth for 8���9 months of the year, with a 3���4 month dry season
    Koppen Climate Classification (All Classes) Tropical: savanna
    Koppen Climate Classification (Major Classes) Tropical
    Fire
    Fire regime niches Eucalypt savanna woodland (monsoon tropical)
    Hydrology
    Drainage Divisions Level 1 Carpentaria Coast
    Drainage Divisions Level 2 ARCHER-WATSON RIVERS
    River Regions ARCHER-WATSON RIVERS
    Marine
    Marine Ecoregions of the World Torres Strait Northern Great Barrier Reef
    States including coastal waters Queensland (including Coastal Waters)
    Political
    ASGS Australian States and Territories Queensland
    Australian States and Territories Queensland
    Commonwealth Electoral Boundaries Leichhardt
    Local Government Areas 2011 Cook (S)
    Local Government Areas 2012 deprecated Cook
    Local Government Areas PSMA 2018 COOK SHIRE
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 59
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 590
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF QLD
    PSMA ABS SA2 Statistical Areas (2016) CAPE YORK
    PSMA ABS SA3 Statistical Areas (2016) FAR NORTH
    PSMA ABS SA4 Statistical Areas (2016) QUEENSLAND - OUTBACK
    PSMA Commonwealth Electoral Boundaries (2016) LEICHHARDT
    PSMA Commonwealth Electoral Boundaries (2018) LEICHHARDT
    PSMA Indigenous Areas (2016) CAPE YORK
    PSMA Indigenous Locations (2016) CAPE YORK WILDERNESS
    PSMA Indigenous Regions (2016) CAPE YORK
    PSMA Localities (2018) COEN
    PSMA Remoteness Areas (2016) Very Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (QLD)
    PSMA State Electoral Boundaries (2016) COOK
    PSMA State Electoral Boundaries (2018) COOK
    PSMA States (2016) QUEENSLAND
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (QLD)
    Statistical Local Areas Cook (S)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Coen Region
    Surface Geology of Australia Qa
    Topography
    Physiographic Provinces of Australia Peninsular Uplands Province
    Physiographic Regions 2011 Wenlock Uplands
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Indigenous owned, Native forest
    Forests of Australia (2013) v2.0 Melaleuca
    Land cover Native forests and woodlands
    NVIS 4.1 Major Vegetation Groups Melaleuca Forests and Woodlands
    NVIS 4.1 Major Vegetation Subgroups Melaleuca open forests and woodlands
    Tenure of Australia's forests (2013) v2.0 Leasehold
    Vegetation - condition Residual
    Vegetation types - native Melaleuca forests and woodlands
    Vegetation types - present Melaleuca forests and woodlands

    Environmental sampling for this location

    Area Management
    Beef numbers 1397616.0 dse
    Dairy numbers 0.0 dse
    Dolomite (acidity) 2.0 t/ha
    Dolomite (physical) 1.0 t/ha
    Lime 1.0 t/ha
    Natural resource management expenditure 3087449.0 $
    Natural resource management expenditure - additional 0.0 $/ha
    Nitrogen 0.043785 t/ha
    Sheep numbers 0.0 dse
    Area management
    Phosphorus 0.031928 t/ha
    Potassium 0.090036 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.3127
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.5073
    Endemism 0.046196938
    Endemism (Non-marine) 0.04694646
    Mammals – Fritz et al 2009 - 0.5 degree 0.2691
    Migratory species (2008) 7.0 frequency
    Occurrence Density 582.0 frequency
    Shannon Diversity (H) 0.6145594 index
    Species Richness 29.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 14.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.63845986
    2030A1BMk35M: Aridity index - month max 2.4217486
    2030A1BMk35M: Aridity index - month min 0.009109311
    2030A1BMk35M: Evaporation - annual mean 191.18834 mm
    2030A1BMk35M: Evaporation - month max 276.64 mm
    2030A1BMk35M: Evaporation - month min 142.17 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.41 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.17 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.38 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 71.0302 %
    2030A1BMk35M: Humidity - month max relative 3pm 80.63192 %
    2030A1BMk35M: Humidity - month min relative 3pm 61.87824 %
    2030A1BMk35M: Precipitation - annual mean 106.25584 mm
    2030A1BMk35M: Precipitation - driest month 2.52 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.12584257
    2030A1BMk35M: Precipitation - max difference between successive months 5.3467746 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -4.557785 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 37.251717
    2030A1BMk35M: Precipitation - spring or autumn season -6.807785
    2030A1BMk35M: Precipitation - summer or winter season 34.665207
    2030A1BMk35M: Precipitation - wettest month 344.3 mm
    2030A1BMk35M: Precipitation deficit - annual mean -84.9325 mm
    2030A1BMk35M: Precipitation deficit - month max -274.12003 mm
    2030A1BMk35M: Precipitation deficit - month min 202.12999 mm
    2030A1BMk35M: Radiation - max month precipitation modified 26.85 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 19.875834 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 15.21 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 31.623333 degrees C
    2030A1BMk35M: Temperature - annual min mean 21.6825 degrees C
    2030A1BMk35M: Temperature - annual range 15.949982 degrees C
    2030A1BMk35M: Temperature - coldest month min 18.48 degrees C
    2030A1BMk35M: Temperature - coolest month max 28.86 degrees C
    2030A1BMk35M: Temperature - max difference in max 1.9400024 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 1.7000122 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 11.73999 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 9.940831 degrees C
    2030A1BMk35M: Temperature - min difference in max -1.8499756 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -1.9799805 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 8.089996 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 34.43 degrees C
    2030A1BMk35M: Temperature - warmest month min 24.07 degrees C
    Aridity index - annual mean 0.7336766
    Aridity index - month max 2.4820607
    Aridity index - month min 0.013903304
    Evaporation - annual mean 174.60672 (ml/5km x 5km pixel)
    Evaporation - average 25809.0 ml
    Evaporation - month max 245.47461 mm
    Evaporation - month min 126.59857 mm
    Evaporation - variability 12.0 %
    Growth index C3 macrotherm plants - annual mean 0.44 index
    Growth index C3 mesotherm plants - annual mean 0.3 index
    Growth index C4 megatherm plants - annual mean 0.38 index
    Humidity - annual mean relative 80.61654 %
    Humidity - annual mean relative 3pm 70.24156 %
    Humidity - month max relative 87.17876 %
    Humidity - month max relative 3pm 79.60953 %
    Humidity - month min relative 61.089188 %
    Humidity - month min relative 3pm 61.089188 %
    Precipitation - annual 1329.0 mm
    Precipitation - annual (Bio12) 1355.0 mm
    Precipitation - annual (log) seasonality index 0.36357662
    Precipitation - annual mean 111.445816 mm
    Precipitation - annual seasonality 5.5663385
    Precipitation - annual seasonality ratio 6.597963
    Precipitation - autumn 434.0 mm
    Precipitation - autumn reliability 33.0 %
    Precipitation - coldest quarter (Bio19) 24.0 mm
    Precipitation - driest month 3.0 mm
    Precipitation - driest period (Bio14) 0.0 mm
    Precipitation - driest quarter (Bio17) 16.0 mm
    Precipitation - equinox seasonality ratio 0.16187379
    Precipitation - max difference between successive months 4.066694 mm/day
    Precipitation - min difference between successive months -5.12364 mm/day
    Precipitation - seasonality (Bio15) 115.0 mm
    Precipitation - solstice seasonality ratio 28.793762
    Precipitation - spring 69.0 mm
    Precipitation - spring or autumn (log) season -0.42426518
    Precipitation - spring or autumn season -5.1048265
    Precipitation - spring reliability 16.0 %
    Precipitation - summer 806.0 mm
    Precipitation - summer or winter (log) season 0.98782736
    Precipitation - summer or winter season 26.835356
    Precipitation - summer reliability 62.0 %
    Precipitation - warmest quarter (Bio18) 524.0 mm
    Precipitation - wettest month 314.22534 mm
    Precipitation - wettest period (Bio13) 90.0 mm
    Precipitation - wettest quarter (Bio16) 942.0 mm
    Precipitation - winter 27.0 mm
    Precipitation - winter reliability 28.0 %
    Precipitation deficit - annual mean -63.1609 mm
    Precipitation deficit - month max -233.47461 mm
    Precipitation deficit - month min 187.62677 mm
    Radiation - annual mean (Bio20) 19.7 MJ/m2/day
    Radiation - coldest quarter (Bio27) 16.9 MJ/m2/day
    Radiation - driest quarter (Bio25) 19.4 MJ/m2/day
    Radiation - highest period (Bio21) 26.6 MJ/m2/day
    Radiation - lowest period (Bio22) 14.9 MJ/m2/day
    Radiation - max month precipitation modified 26.5 MJ/m2/day
    Radiation - mean annual precipitation modified 19.725 MJ/m2/day
    Radiation - min month precipitation modified 15.1 MJ/m2/day
    Radiation - seasonality (Bio23) 17.0
    Radiation - warmest quarter (Bio26) 23.3 MJ/m2/day
    Radiation - wettest quarter (Bio24) 19.0 MJ/m2/day
    Temperature - annual max mean 30.023333 degrees C
    Temperature - annual mean (Bio01) 25.9 degrees C
    Temperature - annual min mean 19.966667 degrees C
    Temperature - annual range 15.899994 degrees C
    Temperature - annual range (Bio07) 16.3 degrees C
    Temperature - coldest month min 16.66 degrees C
    Temperature - coldest period min (Bio06) 17.6 degrees C
    Temperature - coldest quarter mean (Bio11) 23.3 degrees C
    Temperature - coolest month max 27.29 degrees C
    Temperature - diurnal range mean (Bio02) 9.9 degrees C
    Temperature - driest quarter mean (Bio09) 24.1 degrees C
    Temperature - isothermality (Bio03) 0.61 %
    Temperature - max absolute mean max 38.0 degrees C
    Temperature - max difference in max 1.8299866 degrees C/day
    Temperature - max difference in min 1.6300049 degrees C/day
    Temperature - max month diurnal range 11.790009 degrees C
    Temperature - mean annual absolute mean min 12.147351 degrees C
    Temperature - mean annual diurnal range 10.056668 degrees C
    Temperature - min absolute mean min 1.830688 degrees C
    Temperature - min difference in max -1.5 degrees C/day
    Temperature - min difference in min -1.8000183 degrees C/day
    Temperature - min month diurnal range 8.109985 degrees C
    Temperature - month hottest maximum 32.87 degrees C
    Temperature - month mean absolute max 35.832012 degrees C
    Temperature - seasonality (Bio04) 0.62
    Temperature - warmest month min 22.43 degrees C
    Temperature - warmest period max (Bio05) 33.9 degrees C
    Temperature - warmest quarter (Bio10) 28.0 degrees C
    Temperature - wettest quarter mean (Bio08) 27.4 degrees C
    Vapour pressure deficit - annual mean 0.5217667 KPa
    Vapour pressure deficit - annual mean 9am 0.5948515 KPa
    Vapour pressure deficit - month max 0.9348128 KPa
    Vapour pressure deficit - month max 9am 0.9348128 KPa
    Vapour pressure deficit - month min 0.3397596 KPa
    Vapour pressure deficit - month min 9am 0.45061684 KPa
    Wind run - annual mean 140.4507 km/day
    Wind run - month max 196.99983 km/day
    Wind run - month min 93.8 km/day
    Wind speed - annual mean 3pm 3.3416667 m/s
    Wind speed - annual mean 9am 2.191677 m/s
    Wind speed - annual mean 9am or 3pm 4.0 m/s
    Wind speed - month max 3pm 4.7 m/s
    Wind speed - month max 9am 3.3 m/s
    Wind speed - month max 9am or 3pm 4.7 m/s
    Wind speed - month min 3pm 2.2 m/s
    Wind speed - month min 9am 1.4 m/s
    Wind speed - month min 9am or 3pm 1.4 m/s
    WorldClim: Precipitation - annual 1433.0 mm
    WorldClim: Precipitation - coldest quarter 27.0 mm
    WorldClim: Precipitation - driest month 5.0 mm
    WorldClim: Precipitation - driest quarter 18.0 mm
    WorldClim: Precipitation - seasonality 109.0
    WorldClim: Precipitation - warmest quarter 569.0 mm
    WorldClim: Precipitation - wettest month 336.0 mm
    WorldClim: Precipitation - wettest quarter 978.0 mm
    WorldClim: Temperature - annual mean 256.0 degrees C * 10
    WorldClim: Temperature - annual range 155.0 degrees C * 10
    WorldClim: Temperature - coldest month min 176.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 230.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 96.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 235.0 degrees C * 10
    WorldClim: Temperature - isothermality 61.0 %
    WorldClim: Temperature - seasonality 1788.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 331.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 276.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 270.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.3361547 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.08602325 km
    Euclidean Distance to Coast (metres) 30764.193 m
    Remoteness index 15.829507
    Fire
    Fire - time since last 11.0 years
    Fire frequency 2.0 frequency
    Hydrology
    Drainage - average 1750.0 megalitres/5x5km/year
    Drainage - variability 55.0 %
    Runoff - average 5758.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Marine
    Great Barrier Reef 100m DEM 153.03 m
    Social
    Age 40.5 years
    Age - prime group 28.3 Count
    Disadvantaged 867.438 points (mean=1000)
    Education - degrees 7.4 %
    Education - vocational training 23.5 %
    Employment 21.9 %
    Home ownership 48.5 %
    Income - high 19.8 %
    Income - low 20.6 %
    Internet 32.4 %
    Population - change 6.3 count
    Population - density SLA 2006 p/sqkm) 0.0 people/km^2
    Unemployment rate 4.2 %
    Work force - older 33.1 Count
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.48720136
    2030A1BMk35M: Crop factor - month max 0.9
    2030A1BMk35M: Crop factor - month min 0.009109311
    2030A1BMk35M: Water deficit - month max 76.19097 mm
    2030A1BMk35M: Water deficit - month mean 15.548669 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -0.93267024 MPa
    2030A1BMk35M: Water potential - month max -2.8643754E-14 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 43.848125
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 0.819838
    2030A1BMk35M: Water surplus - annual mean 23.6155 mm
    2030A1BMk35M: Water surplus - month max 168.16199 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 58.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.64 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 22.0 %
    Bouguer gravity anomalies 227.3647 Gal
    Bulk density 1.2938086 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic 0.6477888 %
    Carbon store pre-European 61.92246 kgC/ha
    Clay % 29.936523 %
    Crop factor - annual mean 0.5459428
    Crop factor - month max 0.90000004
    Crop factor - month min 0.013903304
    Erodibility 65.0 k factor
    Erosional surfaces - proportion 100.0 %
    Erosivity 10910.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 146.15385 mm/h
    Hydrological conductivity - uncertainty 8.384615
    Lithology - age range 2.588 my
    Lithology - fertility 2.0 index
    Lithology - mean age 1.294 my
    Lithology - mean age (log) 0.11193429 log my
    Lithology - mean age range (log) 0.41296428 log my
    Magnetic anomalies 32.0 nT
    Moisture - average 43.0 %
    Moisture - variability 14.0 %
    Moisture Index - annual mean (Bio28) 0.51
    Moisture Index - coldest quarter mean (Bio35) 0.09
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 1.0
    Moisture Index - lowest period (Bio30) 0.01
    Moisture Index - lowest quarter mean (Bio33) 0.03
    Moisture Index - seasonality (Bio31) 84.0
    Moisture Index - warmest quarter mean (Bio34) 0.59
    Nitrogen - plant-available pre-European 5399.605 kgN/ha
    Nitrogen concentration pre-European 39.52637 mgN kg/H2O
    Nitrogen store pre-European 108.9782 kgN/ha
    Nutrient status 1.0 index
    Pedality hydrological score 0.0
    Phosphorus - plant-available pre-European 19.99033 kgP/ha
    Phosphorus - plant-available total pre-European 806.99603 kgP/ha
    Phosphorus pre-European 7.250486 mgP kg/H2O
    Soil depth 1.4 m
    Soil pedality 2.0
    Soils - coarse 0.0 class
    Substrate data reliability 1.0
    Topographic wetness index 9.589628
    Unreliable water retention parameters 0.0
    Water deficit - month max 81.06201 mm
    Water deficit - month mean 11.678533 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 64250.0 mm
    Water holding capacity - plant-available 202.0 mm
    Water potential - annual mean -0.89510024 MPa
    Water potential - month max -2.8643754E-14 MPa
    Water potential - month min -1.5 MPa
    Water stress index - annual mean 49.13485
    Water stress index - month max 81.0
    Water stress index - month min 1.2512974
    Water surplus - annual mean 26.55329 mm
    Water surplus - month max 161.20532 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 1.75003 Weathering Intensity Index
    Topography
    Aspect 282.0 degrees
    Averaged Topographic Relief 120.125 metres
    Bathymetry and Topography 9 sec 147.0 m
    Elevation 144.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Slope length 1000.0 m
    Topographic Slope (degrees) 0.29151955 degrees
    Topographic relief 9.835464 m
    Topographic roughness 1.773476 %
    Topographic slope (%) 0.5896549 %
    Valley bottom % 18.75 %
    Valley bottom flatness index 1.919299
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.2844 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 12.0 %
    Gross Primary Productivity (2012-03-13) 0.0019 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.3 m^2 plant / m^2 ground
    NDVI Mean 60.0 NDVI x 100
    NPP Mean 5.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.3376 NDVI