Occurrence record: Ecosystem biomonitoring with eDNA: metabarcoding across the tree of life in a tropical marine environment - PLANT-1

EnvironmentalDNA of Apiaceae recorded on 2015-03-17

Dataset

Data resource Ecosystem biomonitoring with eDNA: metabarcoding across the tree of life in a tropical marine environment
Catalog number PLANT-1
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated sequences https://datadryad.org/resource/doi:10.5061/dryad.qq11c
Associated references https://www.nature.com/articles/s41598-017-12501-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Occurrence date 2015-03-17
Supplied date "17/03/2015"
Date precision Day

Taxonomy

Scientific name Apiaceae
Taxon rank family
Kingdom Plantae
Phylum Charophyta
Supplied as "Streptophyta"
Class Equisetopsida
Order Apiales
Family Apiaceae
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Western Australia
Locality Australia, West Australia, Coral Bay
Habitat coral reef
Latitude -23.154793
Longitude 113.766328
Geodetic datum EPSG:4326
Coordinate precision Unknown
Verbatim depth 0.5
Biome Marine

Additional properties

alt elev sea level
biotic relationship environmental
chimera check Perseus
collection date 17/03/2015
data type comment You are viewing a record derived from DNA analysis, if you want further info on this type of occurrence record please go to this page: https://www.ala.org.au/environmentaldna/
env biome coral reef
env feature ocean
env material seawater
env package seawater
experimental factor environmental DNA survey
geo loc name Australia, West Australia, Coral Bay
investigation type survey, eukaryotes
lat lon -23.154793_113.766328
lib const meth Illumina single-end sequencing
lib reads seqd 67633
nucl acid ext Qiagen Dneasy Blood & Tissue Kit
pcr cond initial denaturation at 95°C for 5 min, followed by 40 cycles of 30 s at 95°C, 30 s at 52°C and 45 s at 72°C, with a final extension for 10 min at 72°C
pcr primers 5’ CGAAATCGGTAGACGCTACG 3’ / 5’ CCATTGAGTCTCTGCACCTATC 3’
project name Ecosystem biomonitoring with eDNA: metabarcoding across the tree of life in a tropical marine environment
samp collect device bottle
samp mat process filtering seawater
samp size 9L
seq meth Illumina sequencing by synthesis
seq quality check Average PHRED score >25
source mat id Data pooled from nine DNA samples - AWFS-15-001; AWFS-15-002; AWFS-15-003; AWFS-15-004; AWFS-15-005; AWFS-15-006; AWFS-15-007; AWFS-15-008; AWFS-15-009
Dryad Digital Repository
target gene trnL

User flagged issues 

    Data quality tests

    Test name Result
    Habitat incorrect for species Failed
    Geodetic datum assumed WGS84 Warning
    Country inferred from coordinates Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Depth out of range Passed
    Depth value non-numeric Passed
    Depth value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Location not supplied Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 12 missing properties
    Show/Hide 46 tests that have not been run

    Additional political boundaries information

    Area Management
    CAPAD 2010 Marine Ningaloo
    CAPAD 2012 Marine Ningaloo
    CAPAD 2014 Marine Ningaloo
    CAPAD 2016 Marine Ningaloo
    Global 200 priority ecoregions - Marine Western Australia Marine
    NRM Regions 2010 Rangelands
    NRM Regions 2014 Rangelands
    NRM Regions 2015 Rangelands
    NRM Regions 2017 Rangelands Region
    NRM Regions 2017 (Qld 2019) Rangelands Region
    Area management
    National Landcare Program Management Units 2018 Rangelands Region
    Biodiversity
    Freshwater Ecoregions of the World Pilbara
    IMCRA 4 Regions Central Western Shelf Transition
    IMCRA Meso-scale Bioregions Ningaloo
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Desert, supporting very little plant growth due to water limitation
    Marine
    FAO Fishery Statistical Areas 57
    Global Seagrass Species Richness (2003) 9.00000000
    Marine Ecoregions of the World Ningaloo
    States including coastal waters Western Australia (including Coastal Waters)
    Political
    Local Government Areas PSMA 2018 SHIRE OF CARNARVON
    Native Title Determinations (13/7/2020) Gnulli, Gnulli #2 and Gnulli #3 - Yinggarda, Baiyungu and Thalanyji People WCD2019/016
    PSMA Localities (2018) LYNDON
    PSMA State Electoral Boundaries (2016) MINING AND PASTORAL REGION
    PSMA State Electoral Boundaries (2018) MINING AND PASTORAL REGION
    PSMA Wards (2018) GASCOYNE-MINILYA WARD
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Indigenous owned, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    IGBP Land Cover vegetation classification scheme (2011) Open shrublands
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Other Crown Land

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 6180020.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.5479
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 0.0
    Endemism 0.10494173
    Endemism (Non-marine) 0.12790336
    Mammals – Fritz et al 2009 - 0.5 degree 0.0
    Migratory species (2008) 13.0 frequency
    Occurrence Density 81884.0 frequency
    Shannon Diversity (H) 2.965482 index
    Species Richness 1500.0 frequency
    Threatened species (2008) 4.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.09019169
    2030A1BMk35M: Evaporation - month min 121.13917 mm
    2030A1BMk35M: Precipitation - annual mean 15.78625 mm
    2030A1BMk35M: Precipitation - driest month 0.0 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.049659524
    2030A1BMk35M: Precipitation - spring or autumn season -14.509974
    2030A1BMk35M: Temperature - annual max mean 32.200558 degrees C
    2030A1BMk35M: Temperature - annual min mean 18.916182 degrees C
    2030A1BMk35M: Temperature - annual range 24.817505 degrees C
    Precipitation - annual 238.0 mm
    Precipitation - annual (Bio12) 233.2 mm
    Precipitation - coldest quarter (Bio19) 97.8 mm
    Precipitation - driest period (Bio14) 0.0 mm
    Precipitation - driest quarter (Bio17) 5.0 mm
    Precipitation - seasonality (Bio15) 84.0 mm
    Precipitation - warmest quarter (Bio18) 71.4 mm
    Precipitation - wettest period (Bio13) 12.0 mm
    Precipitation - wettest quarter (Bio16) 123.2 mm
    Radiation - annual mean (Bio20) 22.9 MJ/m2/day
    Radiation - seasonality (Bio23) 28.0
    Radiation - warmest quarter (Bio26) 27.6 MJ/m2/day
    Temperature - annual mean (Bio01) 24.46 degrees C
    Temperature - annual range (Bio07) 25.62 degrees C
    Temperature - coldest period min (Bio06) 11.82 degrees C
    Temperature - coldest quarter mean (Bio11) 18.82 degrees C
    Temperature - diurnal range mean (Bio02) 13.18 degrees C
    Temperature - driest quarter mean (Bio09) 24.84 degrees C
    Temperature - isothermality (Bio03) 0.51 %
    Temperature - seasonality (Bio04) 1.4760001
    Temperature - warmest period max (Bio05) 37.440002 degrees C
    Temperature - warmest quarter (Bio10) 29.94 degrees C
    Temperature - wettest quarter mean (Bio08) 19.98 degrees C
    Wind run - annual mean 351.25128 km/day
    Distance
    Distance - to any water (weighted) 0.042426407 degrees
    Distance - to coast 0.03 km x 100
    Distance - to non-permanent water (weighted) 0.042426407 degrees
    Distance - to permanent water (weighted) 0.49648765 km
    Euclidean Distance to Coast (metres) 3460.788 m
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    Sea Surface Temperature - MODIS Terra 24.121971 Degrees C
    SeaWIFS K490 Mean 0.07597061 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.57940197 mg/m^3
    Substrate
    2030A1BMk35M: Water stress index - month max 35.09992
    Bulk density 1.385 Mg/m^3
    Clay % 8.75 %
    Hydrologic conductivity - average saturated 299.99994 mm/h
    Moisture Index - annual mean (Bio28) 0.11
    Moisture Index - highest quarter mean (Bio32) 0.3
    Nutrient status 1.0 index
    Soil depth 0.4 m
    Soil pedality 1.3
    Water holding capacity 72000.0 mm
    Weathering Intensity V2 4.7851 Weathering Intensity Index
    Topography
    Aspect 287.0 degrees
    Averaged Topographic Relief 58.25 metres
    Bathymetry and Elvation 9 sec 0.0 m
    Elevation 0.0 m
    Topographic Slope (degrees) 0.06829452 degrees
    Topographic relief 20.6469 m
    Topographic slope (%) 2.628599 %
    NPP Mean 0.0 tonnes/ha/yr