Occurrence record: BOLD - Australian records - 3773508

GenomicDNA of LEPIDOPTERA | Moths recorded on 1964-04-04

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3773508
Other catalog numbers recordID:1651631;ProcessID:ANICJ947-10;sampleID:10ANIC-06944
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Common, I.F.B.|Upton, M.S.
Supplied as "I.F.B.Common, M.S.Upton"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 1964-04-04
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province Queensland
Locality Bamaga, Cape York
Latitude -10.7
Longitude 142.517
Geodetic datum EPSG:4326
Coordinate precision Unknown
Georeference protocol Google earth
Biome Marine

Additional properties

genbank accession HQ950123
markercode COI-5P
nucleotides AACATTATATTTTATTTTTGGAATTTGATCTGGTATAGTAGGAACTTCTCTTAGATTATTAATTCGAGCAGAGTTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCCTTCATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGACTCTTACCCCCATCATTAATTTTATTAATTTCTAGAAGAATTGTAGAAAACGGAGCAGGAACTGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCTCATAGTGGAAGATCTGTTGATTTAGCTATTTTTTCATTACACTTAGCTGGTATTTCATCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGTTTAAATAATTTATCTTTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACAGCATTTTTACTCTTACTTTCATTACCAGTATTAGCAGGTGCGATTACTATATTATTAACAGATCGAAATCTTAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:43Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Missing georeferenced protocol Passed
    Coordinates dont match supplied state Passed
    Show/Hide 12 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Coral Ecoregions Torres Strait & far Northern GBR
    Australian Tropical Savanna Australian Tropical Savanna
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Irrigation practice - dominant No irrigation
    Land use Water
    NRM Regions 2010 Torres Strait
    NRM Regions 2014 Torres Strait
    NRM Regions 2015 Torres Strait
    NRM Regions 2017 Torres Strait
    NRM Regions 2017 (Qld 2019) Torres Strait
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Torres Strait
    Biodiversity
    IMCRA 4 Regions Northern Shelf Province
    IMCRA Meso-scale Bioregions West Cape York
    World Anthropogenic Biomes (2000) Inhabited treeless and barren lands
    Climate
    Agroclimatic classification of Australia Strongly developed wet and dry seasons with plant growth determined by moisture availability
    Marine
    FAO Fishery Statistical Areas 71
    Geomorphology of the Australian Margin and adjacent seafloor Shelf
    Global Seagrass Species Richness (2003) 14.00000000
    Marine Ecoregions of the World Arnhem Coast to Gulf of Carpenteria
    States including coastal waters Queensland (including Coastal Waters)
    Political
    Local Government Areas PSMA 2018 TORRES SHIRE
    PSMA Localities (2018) SOMERSET
    PSMA State Electoral Boundaries (2016) COOK
    PSMA State Electoral Boundaries (2018) COOK
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Native forest
    Forests of Australia (2013) v2.0 Mangrove
    Land cover Ephemeral and Permanent Water Features
    Tenure of Australia's forests (2013) v2.0 Unresolved Tenure
    Vegetation - condition Modified
    Vegetation types - native Mangroves,tidal mudflats,samphires and bare areas,claypan,sand,rock,salt lakes,lagoons,lakes
    Vegetation types - present Mangroves

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure - additional 0.0 $/ha
    Biodiversity
    Endemism 0.03698365
    Endemism (Non-marine) 0.044295404
    Occurrence Density 13703.0 frequency
    Shannon Diversity (H) 6.5493646 index
    Species Richness 2052.0 frequency
    Threatened communities (2008) 0.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.90601134
    2030A1BMk35M: Aridity index - month max 3.3481534
    2030A1BMk35M: Aridity index - month min 0.020790022
    2030A1BMk35M: Evaporation - annual mean 184.91292 mm
    2030A1BMk35M: Evaporation - month max 256.58 mm
    2030A1BMk35M: Evaporation - month min 123.48 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.47 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.16 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.44 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 79.253815 %
    2030A1BMk35M: Humidity - month max relative 3pm 84.80667 %
    2030A1BMk35M: Humidity - month min relative 3pm 74.520096 %
    2030A1BMk35M: Precipitation - annual mean 137.83667 mm
    2030A1BMk35M: Precipitation - driest month 4.8 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.08380123
    2030A1BMk35M: Precipitation - max difference between successive months 5.371742 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -5.947796 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 21.971815
    2030A1BMk35M: Precipitation - spring or autumn season -10.725305
    2030A1BMk35M: Precipitation - summer or winter season 20.494423
    2030A1BMk35M: Precipitation - wettest month 413.43 mm
    2030A1BMk35M: Precipitation deficit - annual mean -47.07625 mm
    2030A1BMk35M: Precipitation deficit - month max -247.11998 mm
    2030A1BMk35M: Precipitation deficit - month min 289.94998 mm
    2030A1BMk35M: Radiation - max month precipitation modified 26.66 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 19.6325 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 15.01 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 30.566668 degrees C
    2030A1BMk35M: Temperature - annual min mean 24.386667 degrees C
    2030A1BMk35M: Temperature - annual range 9.820007 degrees C
    2030A1BMk35M: Temperature - coldest month min 22.54 degrees C
    2030A1BMk35M: Temperature - coolest month max 28.85 degrees C
    2030A1BMk35M: Temperature - max difference in max 1.2900085 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 1.2000122 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 7.210022 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 6.1800027 degrees C
    2030A1BMk35M: Temperature - min difference in max -1.0299988 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -1.1300049 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 5.5 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 32.36 degrees C
    2030A1BMk35M: Temperature - warmest month min 25.73 degrees C
    Precipitation - annual (Bio12) 1714.0 mm
    Precipitation - coldest quarter (Bio19) 37.0 mm
    Precipitation - driest period (Bio14) 1.0 mm
    Precipitation - driest quarter (Bio17) 23.0 mm
    Precipitation - seasonality (Bio15) 109.0 mm
    Precipitation - spring or autumn season -7.95713
    Precipitation - warmest quarter (Bio18) 477.0 mm
    Precipitation - wettest period (Bio13) 109.0 mm
    Precipitation - wettest quarter (Bio16) 1110.0 mm
    Precipitation deficit - annual mean -16.855732 mm
    Precipitation deficit - month max -190.58124 mm
    Radiation - annual mean (Bio20) 19.6 MJ/m2/day
    Radiation - coldest quarter (Bio27) 17.3 MJ/m2/day
    Radiation - driest quarter (Bio25) 21.1 MJ/m2/day
    Radiation - highest period (Bio21) 27.1 MJ/m2/day
    Radiation - lowest period (Bio22) 14.7 MJ/m2/day
    Radiation - seasonality (Bio23) 18.0
    Radiation - warmest quarter (Bio26) 23.5 MJ/m2/day
    Radiation - wettest quarter (Bio24) 18.5 MJ/m2/day
    Temperature - annual mean (Bio01) 26.8 degrees C
    Temperature - annual range (Bio07) 9.9 degrees C
    Temperature - coldest period min (Bio06) 21.9 degrees C
    Temperature - coldest quarter mean (Bio11) 25.3 degrees C
    Temperature - diurnal range mean (Bio02) 6.1 degrees C
    Temperature - driest quarter mean (Bio09) 25.9 degrees C
    Temperature - isothermality (Bio03) 0.62 %
    Temperature - seasonality (Bio04) 0.35
    Temperature - warmest period max (Bio05) 31.8 degrees C
    Temperature - warmest quarter (Bio10) 28.0 degrees C
    Temperature - wettest quarter mean (Bio08) 27.4 degrees C
    Wind run - annual mean 323.8149 km/day
    Wind run - month max 427.90244 km/day
    Wind run - month min 217.97574 km/day
    Wind speed - annual mean 3pm 5.8597355 m/s
    Wind speed - annual mean 9am 4.766667 m/s
    Wind speed - annual mean 9am or 3pm 6.85 m/s
    Wind speed - month max 3pm 7.6 m/s
    Wind speed - month max 9am 6.1 m/s
    Wind speed - month max 9am or 3pm 7.6 m/s
    Wind speed - month min 3pm 4.3 m/s
    Wind speed - month min 9am 3.1 m/s
    Wind speed - month min 9am or 3pm 3.1 m/s
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.02236068 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.03 km
    Euclidean Distance to Coast (metres) 1230.291 m
    Marspec Distance to Shore 1.0 km
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    GEOMACS - geometric mean 0.042602 Pascals
    Great Barrier Reef 100m DEM -7.9225206 m
    Marspec Annual Range in Sea Surface Salinity 1.5999999 100 x psu
    Marspec Annual Range in Sea Surface Temperature 4.41 100 x degrees C
    Marspec Annual Variance in Sea Surface Salinity 23.689999 100 x psu
    Marspec Annual Variance in Sea Surface Temperature 2.3587 10,000 x degrees C
    Marspec Bathymetric Slope 0.0 10 x degrees
    Marspec Concavity 0.001 1000 x degrees
    Marspec East/West Aspect 0.0 radians
    Marspec Maximum Monthly Sea Surface Salinity 35.53 100 x psu
    Marspec Mean Annual Sea Surface Salinity 34.739998 100 x psu
    Marspec Mean Annual Sea Surface Temperature 26.58 100 x degrees C
    Marspec Minimum Monthly Sea Surface Salinity 33.93 100 x psu
    Marspec North/South Aspect 1.0 1 x radians
    Marspec Plan Curvature 0.0 x 10000
    Marspec Profile Curvature -1.0E-4 x 10000
    Marspec Sea Surface Temperature of the coldest ice-free month 24.16 100 x degrees C
    Marspec Sea Surface Temperature of the warmest ice-free month 28.57 100 x degrees C
    Sea Surface Temperature - MODIS Terra 27.16421 Degrees C
    SeaWIFS K490 Mean 0.10228177 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.9063516 mg/m^3
    Social
    Age 26.7 years
    Age - prime group 28.6 Count
    Disadvantaged 772.812 points (mean=1000)
    Education - degrees 11.1 %
    Education - vocational training 25.0 %
    Employment 1.9 %
    Home ownership 16.1 %
    Income - high 37.0 %
    Income - low 11.3 %
    Internet 39.7 %
    Population - change 0.8 count
    Population - density SLA 2006 p/sqkm) 3.7 people/km^2
    Unemployment rate 3.5 %
    Work force - older 18.4 Count
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.5213281
    2030A1BMk35M: Crop factor - month max 0.90000004
    2030A1BMk35M: Crop factor - month min 0.020790022
    2030A1BMk35M: Water deficit - month max 74.519165 mm
    2030A1BMk35M: Water deficit - month mean 18.186924 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -0.8361735 MPa
    2030A1BMk35M: Water potential - month max -2.8643754E-14 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 46.919525
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 1.8711017
    2030A1BMk35M: Water surplus - annual mean 52.865498 mm
    2030A1BMk35M: Water surplus - month max 302.29797 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    Bouguer gravity anomalies 545.5844 Gal
    Bulk density 1.3416752 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic -8436.186 %
    Carbon store pre-European 89.5544 kgC/ha
    Clay % 36.21066 %
    Erosional surfaces - proportion 68.75 %
    Hydrologic conductivity - average saturated 140.0 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 2.588 my
    Lithology - fertility 2.0 index
    Lithology - mean age 1.294 my
    Lithology - mean age (log) 0.11193429 log my
    Lithology - mean age range (log) 0.41296428 log my
    Magnetic anomalies -45.0 nT
    Moisture Index - annual mean (Bio28) 0.55
    Moisture Index - coldest quarter mean (Bio35) 0.16
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 1.0
    Moisture Index - lowest period (Bio30) 0.02
    Moisture Index - lowest quarter mean (Bio33) 0.05
    Moisture Index - seasonality (Bio31) 78.0
    Moisture Index - warmest quarter mean (Bio34) 0.54
    Nitrogen - plant-available pre-European 7788.513 kgN/ha
    Nitrogen concentration pre-European 51.826736 mgN kg/H2O
    Nitrogen store pre-European 151.43326 kgN/ha
    Nutrient status 1.3 index
    Pedality hydrological score 2.7586293
    Phosphorus - plant-available pre-European 27.807121 kgP/ha
    Phosphorus - plant-available total pre-European 277.94196 kgP/ha
    Phosphorus pre-European 9.516754 mgP kg/H2O
    Soil depth 1.2 m
    Soil pedality 3.3516483
    Soils - coarse 0.0 class
    Substrate data reliability 1.0
    Topographic wetness index 15.20841
    Unreliable water retention parameters 66.666664
    Water holding capacity - plant-available 56.0 mm
    Weathering Intensity V2 4.01852 Weathering Intensity Index
    Topography
    Averaged Topographic Relief 118.708336 metres
    Bathymetry and Topography 9 sec 20.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Topographic Slope (degrees) 1.3941085 degrees
    Topographic relief 30.46007 m
    Topographic roughness 59.48811 %
    Topographic slope (%) 1.634418 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 0.0
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.1491 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 16.0 %
    Leaf Area Index (LAI) - 2012-03-05 0.3 m^2 plant / m^2 ground
    Normalized Difference Vegetation Index (2012-03-05) 0.2903 NDVI