We have just released new data filter features to improve the way you search and filter data in the ALA. There is now a default data filter in place that excludes lower quality records. You can pre-filter your search results using a suite of other data filters. To learn more, read Getting started with the data profiles.

Occurrence record: BOLD - Australian records - 3643265

GenomicDNA of Trachydora macrostola recorded on 2009-02-15

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3643265
Other catalog numbers recordID:1331510;ProcessID:LEFIA1405-10;sampleID:MM11233
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector Kaila, K.|Kullberg, J.
Supplied as "K. Kaila, J. Kullberg"
Reproductive condition sexual
Sex male
Life stage adult
License CC-BY-Int
Field number MM11233
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Marko Mutanen

Event

Field number MM11233
Occurrence date 2009-02-15
Date precision Day

Taxonomy

Scientific name Trachydora macrostola
Taxon rank species
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Family Cosmopterigidae
Genus Trachydora
Species Trachydora macrostola
Taxonomic issue No issues
Name match metric Canonical name match
The supplied name was parsed into canonical form before a match was found.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Tasmania
Locality 15km W Geeveston

Additional properties

markercode COI-5P
nucleotides GAACATTATATTTTATTTTTGGTATTTGAGCCGGAATAGTAGGAACATCC-TAAGATTATTAATTCGAGCCGAACTAGGAAACCCCGGATCTCTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCAATTATAATTGGTGGATTTGGAAATTGACTTGTTCCTCTTATACTTGGAGCCCCTGATATAGCTTTCCCACGTATAAATAATATAAGATTTTGACTTCTACCACCTTCCTTAACTCTTCTAATCTCCAGAAGAATTGTAGAAAGTGGGGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATCGCCCATGGAGGAAGATCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGTATCTCATCAATTTTAGGAGCAATTAACTTTATTACAACTATTATTAACATGCGAATTAACAGCATATCATTTGATCAACTTCCCTTATTCGTTTGAGCTGTAGGAATTACAGCTCTTCTTCTTCTTCTTTCCCTTCCAGTTTTAGCGGGAGCAATCACTATACTTTTAACTGATCGAAATTTAAATACCTCATTCTTCGACCCAGCAGGAGGAGGAGACCCTATCCTTTACCAACACTTATTTTGATTTTTTGG
Owner institution code University of Oulu
sequence last updated 2011-11-14T08:11:45Z

User flagged issues 

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 56 tests that have not been run