We have just released new data filter features to improve the way you search and filter data in the ALA. There is now a default data filter in place that excludes lower quality records. You can pre-filter your search results using a suite of other data filters. To learn more, read Getting started with the data profiles.

Occurrence record: BOLD - Australian records - 3560546

GenomicDNA of LEPIDOPTERA | Moths recorded on 2006-01-17

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3560546
Other catalog numbers recordID:1418520;ProcessID:GWORY764-10;sampleID:BC EF Lep 00297
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector Friedrich, E.
Supplied as "E. Friedrich"
Reproductive condition sexual
Sex female
Life stage adult
License CC-BY-Int
Field number BC EF Lep 00297
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Egbert Friedrich

Event

Field number BC EF Lep 00297
Occurrence date 2006-01-17
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Queensland
Locality Western Downs (R)
Locality Cherry Plain
Latitude -26.88
Longitude 151.562
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HM913814
markercode COI-5P
nucleotides AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGTACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAACTCCTGGATCATTAATTGGAGACGATCAAATTTATAATACTATTGTTACAGCTCACGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGAGGATTTGGAAATTGACTCGTACCCCTTATATTAGGAGCACCAGATATGGCTTTCCCCCGAATAAATAATATAAGTTTCTGACTTCTCCCTCCTTCTTTAACTTTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCCCATGGAGGTAGATCAGTAGACTTAGCTATTTTTTCCCTTCACTTAGCGGGAATTTCTTCTATTTTAGGAGCCATTAATTTTATTACTACAATTATTAATATACGATTAAATAGCTTATCTTTCGATCAAATACCATTATTTATTTGAGCAGTTGGAATTACTGCATTTTTATTACTTTTATCTTTACCTGTTTTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATCTAAATACATCTTTTTTTGATCCTGCTGGAGGAGGAGACCCCATTTTATACCAACACTTATTT
Owner institution code Research Collection of Egbert Friedrich
sequence last updated 2011-11-14T08:11:20Z

User flagged issues 

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    CAPAD 2010 Terrestrial Bunya Mountains
    CAPAD 2012 Terrestrial Bunya Mountains
    CAPAD 2014 Terrestrial Bunya Mountains
    CAPAD 2016 Terrestrial Bunya Mountains
    Fallow practice - dominant (area) Fallow 3-9 months
    Fallow practice - dominant (number) Fallow 3-9 months
    GER National Corridor GER National Corridor
    GER Standard Boundary GER Standard Boundary
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    Important Bird Areas (IBA) Australia Bunya Mountains & Yarraman IBA
    Irrigation practice - dominant 6. Local knowledge
    Land use Nature conservation
    Murray Darling Basin Authority Water Quality Zones Upland
    Murray-Darling Basin Boundary Murray-Darling Basin Boundary
    Murray-Darling Basin Ground Water Plan Areas GW21
    Murray-Darling Basin Ground Water Plan Areas (2018) Condamine-Balonne
    Murray-Darling Basin Ground Water SDL Resource Units Upper Condamine Basalts (GS65)
    Murray-Darling Basin Ground Water SDL Resource Units (2018) Upper Condamine Basalts (GS65)
    Murray-Darling Basin Surface Water Plan Areas SW19
    Murray-Darling Basin Surface Water Plan Areas (2019) Condamine-Balonne
    Murray-Darling Basin Surface Water SDL Resource Units SS26
    Murray-Darling Basin Surface Water SDL Resource Units (2019) Condamine���Balonne
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Valleys CONDAMINE
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Zones slopes
    NRM Regions 2010 Condamine
    NRM Regions 2014 Condamine
    NRM Regions 2015 Condamine
    NRM Regions 2017 Condamine
    NRM Regions 2017 (Qld 2019) Southern Queensland Landscapes
    Stubble practice - dominant (area) Stubble ploughed in
    Stubble practice - dominant (number) Stubble ploughed in
    Tillage practice - dominant (area) Other cultivation
    Tillage practice - dominant (number) Other cultivation
    Area management
    National Landcare Program Management Units 2018 Condamine
    Biodiversity
    Freshwater Ecoregions of the World Murray - Darling
    IBRA 6 Regions Brigalow Belt South
    IBRA 6 Sub Regions Eastern Darling Downs
    IBRA 7 Regions Brigalow Belt South
    IBRA 7 Subregions Eastern Darling Downs
    Terrestrial Ecoregional Boundaries Brigalow Tropical Savanna
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Moisture is the main limit on crop growth. Growth index lowest in spring
    Koppen Climate Classification (All Classes) Temperate: no dry season (hot summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Rainforest (tropical)
    Hydrology
    Drainage Divisions Level 1 Murray-Darling Basin
    Drainage Divisions Level 2 DARLING RIVER
    River Regions CONDAMINE-CULGOA RIVERS
    Marine
    Marine Ecoregions of the World Tweed-Moreton
    States including coastal waters Queensland (including Coastal Waters)
    Political
    ASGS Australian States and Territories Queensland
    Australian States and Territories Queensland
    Commonwealth Electoral Boundaries Maranoa
    Indigenous Land Use Agreements Barunggam, Cobble Cobble, Jarowair, Western Wakka Wakka, Yiman and QGC ILUA
    Local Government Areas 2011 Western Downs (R)
    Local Government Areas 2012 deprecated Wambo
    Local Government Areas PSMA 2018 WESTERN DOWNS REGIONAL
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water Barunggam, Bidjara, Bigambul, Euahlayi, Gomeroi/Kamilaroi, Giabel, Githabul, Gunggari, Guwamu/Kooma, Jarowair, Kambuwal, Mandandanji, Murrawarri, Wakka Wakka
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water (2019) Barunggam, Bidjara, Bigambul, Euahlayi, Gomeroi/Kamilaroi, Giabel, Githabul, Gunggari/Kungarri, Guwamu (Kooma), Jarowair, Kambuwal, Mandandanji, Murrawarri, Wakka Wakka
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water Barunggam, Bidjara, Bigambul, Euahlayi, Gomeroi/Kamilaroi, Giabel, Githabul, Gunggari, Guwamu/Kooma, Jarowair, Kambuwal, Mandandanji, Murrawarri, Wakka Wakka
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water (2019) Barunggam, Bidjara, Bigambul, Euahlayi, Gomeroi/Kamilaroi, Giabel, Githabul, Gunggari, Guwamu (Kooma), Jarowair, Kambuwal, Mandandanji, Murrawarri, Wakka Wakka
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 3
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 1133
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF QLD
    PSMA ABS SA2 Statistical Areas (2016) WAMBO
    PSMA ABS SA3 Statistical Areas (2016) DARLING DOWNS - EAST
    PSMA ABS SA4 Statistical Areas (2016) DARLING DOWNS - MARANOA
    PSMA Commonwealth Electoral Boundaries (2016) MARANOA
    PSMA Commonwealth Electoral Boundaries (2018) MARANOA
    PSMA Indigenous Areas (2016) WESTERN DOWNS
    PSMA Indigenous Locations (2016) WAMBO
    PSMA Indigenous Regions (2016) TOOWOOMBA - ROMA
    PSMA Localities (2018) BUNYA MOUNTAINS
    PSMA Remoteness Areas (2016) Outer Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (QLD)
    PSMA State Electoral Boundaries (2016) CONDAMINE
    PSMA State Electoral Boundaries (2018) CALLIDE
    PSMA States (2016) QUEENSLAND
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (QLD)
    Statistical Local Areas Western Downs (R) - Wambo
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Clarence-Moreton Region
    Surface Geology of Australia Czbmr
    Topography
    Physiographic Provinces of Australia New England-Moreton Uplands Province
    Physiographic Regions 2011 Toowoomba Plateau
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Other special rights, Native forest
    Forests of Australia (2013) v2.0 Rainforest
    Land cover Native forests and woodlands
    NVIS 4.1 Major Vegetation Groups Rainforests and Vine Thickets
    NVIS 4.1 Major Vegetation Subgroups Dry rainforest or vine thickets
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve
    Vegetation - condition Modified
    Vegetation types - native Eucalypt open woodlands
    Vegetation types - present Eucalyptus open woodlands

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 4230803.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.6147
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 4.0882
    Endemism 0.06363783
    Endemism (Non-marine) 0.06680686
    Mammals – Fritz et al 2009 - 0.5 degree 0.4792
    Migratory species (2008) 6.0 frequency
    Occurrence Density 18488.0 frequency
    Shannon Diversity (H) 5.9126267 index
    Species Richness 2320.0 frequency
    Threatened communities (2008) 2.0 frequency
    Threatened species (2008) 14.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.36108035
    2030A1BMk35M: Evaporation - month min 76.51 mm
    2030A1BMk35M: Precipitation - annual mean 58.675835 mm
    2030A1BMk35M: Precipitation - driest month 19.62 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.9780092
    2030A1BMk35M: Precipitation - spring or autumn season -0.022345303
    2030A1BMk35M: Temperature - annual max mean 24.6275 degrees C
    2030A1BMk35M: Temperature - annual min mean 12.03 degrees C
    2030A1BMk35M: Temperature - annual range 25.180023 degrees C
    Aridity index - annual mean 0.5660406
    Aridity index - month max 0.90059733
    Aridity index - month min 0.33709064
    Evaporation - annual mean 131.93227 (ml/5km x 5km pixel)
    Evaporation - average 20501.0 ml
    Evaporation - month max 206.13466 mm
    Evaporation - month min 59.770004 mm
    Evaporation - variability 12.0 %
    Growth index C3 macrotherm plants - annual mean 0.16 index
    Growth index C3 mesotherm plants - annual mean 0.35 index
    Growth index C4 megatherm plants - annual mean 0.11 index
    Humidity - annual mean relative 79.258736 %
    Humidity - annual mean relative 3pm 64.51626 %
    Humidity - month max relative 87.96691 %
    Humidity - month max relative 3pm 70.83448 %
    Humidity - month min relative 58.702396 %
    Humidity - month min relative 3pm 58.702396 %
    Precipitation - annual 781.0 mm
    Precipitation - annual (Bio12) 786.0 mm
    Precipitation - annual mean 71.88493 mm
    Precipitation - annual seasonality 1.0284802
    Precipitation - coldest quarter (Bio19) 116.0 mm
    Precipitation - driest month 36.485622 mm
    Precipitation - driest period (Bio14) 6.0 mm
    Precipitation - driest quarter (Bio17) 108.0 mm
    Precipitation - equinox seasonality ratio 1.0728914
    Precipitation - seasonality (Bio15) 40.0 mm
    Precipitation - spring or autumn season 0.07249629
    Precipitation - warmest quarter (Bio18) 303.0 mm
    Precipitation - wettest month 121.90219 mm
    Precipitation - wettest period (Bio13) 25.0 mm
    Precipitation - wettest quarter (Bio16) 306.0 mm
    Radiation - annual mean (Bio20) 18.7 MJ/m2/day
    Radiation - seasonality (Bio23) 24.0
    Radiation - warmest quarter (Bio26) 23.3 MJ/m2/day
    Temperature - annual max mean 22.555 degrees C
    Temperature - annual mean (Bio01) 17.0 degrees C
    Temperature - annual min mean 9.241667 degrees C
    Temperature - annual range 24.72348 degrees C
    Temperature - annual range (Bio07) 25.4 degrees C
    Temperature - coldest month min 2.26 degrees C
    Temperature - coldest period min (Bio06) 3.7 degrees C
    Temperature - coldest quarter mean (Bio11) 10.8 degrees C
    Temperature - diurnal range mean (Bio02) 12.4 degrees C
    Temperature - driest quarter mean (Bio09) 11.3 degrees C
    Temperature - isothermality (Bio03) 0.49 %
    Temperature - month hottest maximum 28.11 degrees C
    Temperature - seasonality (Bio04) 1.57
    Temperature - warmest month min 15.31 degrees C
    Temperature - warmest period max (Bio05) 29.1 degrees C
    Temperature - warmest quarter (Bio10) 22.3 degrees C
    Temperature - wettest quarter mean (Bio08) 22.3 degrees C
    Wind run - annual mean 163.52167 km/day
    WorldClim: Precipitation - annual 748.0 mm
    WorldClim: Precipitation - coldest quarter 119.0 mm
    WorldClim: Precipitation - driest month 34.0 mm
    WorldClim: Precipitation - driest quarter 113.0 mm
    WorldClim: Precipitation - seasonality 38.0
    WorldClim: Precipitation - warmest quarter 286.0 mm
    WorldClim: Precipitation - wettest month 103.0 mm
    WorldClim: Precipitation - wettest quarter 286.0 mm
    WorldClim: Temperature - annual mean 168.0 degrees C * 10
    WorldClim: Temperature - annual range 263.0 degrees C * 10
    WorldClim: Temperature - coldest month min 28.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 104.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 135.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 116.0 degrees C * 10
    WorldClim: Temperature - isothermality 51.0 %
    WorldClim: Temperature - seasonality 4670.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 291.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 223.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 223.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.089999996 degrees
    Distance - to coast 1.49459 km x 100
    Distance - to non-permanent water (weighted) 0.089999996 degrees
    Distance - to permanent water (weighted) 0.33541018 km
    Euclidean Distance to Coast (metres) 101528.75 m
    Remoteness index 4.46753
    Hydrology
    Drainage - average 506.0 megalitres/5x5km/year
    Drainage - variability 167.0 %
    Runoff - average 1150.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Marine
    Great Barrier Reef 100m DEM 698.2 m
    Social
    Population - density SLA 2006 p/sqkm) 0.9002882 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 50.144012
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 105.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.2 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 52.0 %
    Bulk density 0.8206838 Mg/m^3
    Carbon - organic 1.539866 %
    Clay % 37.37607 %
    Hydrologic conductivity - average saturated 45.555557 mm/h
    Moisture Index - annual mean (Bio28) 0.5
    Moisture Index - highest quarter mean (Bio32) 0.62
    Nutrient status 2.05 index
    Ph - soil 5.0 ph
    Soil depth 0.6 m
    Soil pedality 2.832906
    Water holding capacity 25000.0 mm
    Water stress index - month max 73.865654
    Weathering Intensity V2 1.86233 Weathering Intensity Index
    Topography
    Aspect 246.0 degrees
    Averaged Topographic Relief 528.5417 metres
    Bathymetry and Elvation 9 sec 720.0 m
    Elevation 829.0 m
    Topographic Slope (degrees) 0.7651374 degrees
    Topographic relief 205.0088 m
    Topographic slope (%) 10.21235 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3889 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 86.0 %
    Fractional Cover - Bare Soil (2012-03-05) 0.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 20.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 80.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0693 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 4.3 m^2 plant / m^2 ground
    NDVI Mean 85.0 NDVI x 100
    NPP Mean 15.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.7787 NDVI