We have just released new data filter features to improve the way you search and filter data in the ALA. There is now a default data filter in place that excludes lower quality records. You can pre-filter your search results using a suite of other data filters. To learn more, read Getting started with the data profiles.

Occurrence record: BOLD - Australian records - 3750075

GenomicDNA of LEPIDOPTERA | Moths recorded on 1996-03-20

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3750075
Other catalog numbers recordID:1651577;ProcessID:ANICJ893-10;sampleID:10ANIC-06890
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector Edwards, E.D.|Nielsen, E.S.
Supplied as "E.D.Edwards, E.S.Nielsen"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Occurrence status present
Abcd identification qualifier Not provided

Event

Occurrence date 1996-03-20
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Western Australia
Locality Lock McNess
Latitude -31.33
Longitude 115.41
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Marine

Additional properties

genbank accession HQ950084
markercode COI-5P
nucleotides AACATTATATTTTATTTTCGGTATTTGATCAGGGATAGTTGGAACTTCCCTTAGATTATTAATTCGAGCAGAATTAGGTAACCCCGGCTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGTGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTTTTACCTCCATCATTAACCCTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCATGGAGGAAGATCGGTAGACTTAGCTATTTTTTCTCTACATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGTATTACTGCATTTCTATTATTAATTTCATTACCAGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATCCTTTATCAACATTTATTT
Owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:43Z

User flagged issues 

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 13 missing properties
    Show/Hide 48 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Coral Ecoregions Direction Bank
    Global 200 priority ecoregions - Freshwater Southwest Australia Rivers & Streams
    Area management
    National Landcare Program Management Units 2018 Marine NRM
    Biodiversity
    IMCRA 4 Regions Southwest Shelf Transition
    IMCRA Meso-scale Bioregions Central West Coast
    Marine
    FAO Fishery Statistical Areas 57
    Geomorphology of the Australian Margin and adjacent seafloor Shelf
    Global Seagrass Species Richness (2003) 13.00000000
    Marine Ecoregions of the World Houtman
    Territorial Sea Territorial Sea
    IGBP Land Cover vegetation classification scheme (2011) Water

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.4962
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 0.0
    Endemism 0.0149426125
    Endemism (Non-marine) 0.015681587
    Mammals – Fritz et al 2009 - 0.5 degree 0.2564
    Occurrence Density 918.0 frequency
    Shannon Diversity (H) 5.3840384 index
    Species Richness 360.0 frequency
    Distance
    Euclidean Distance to Coast (metres) 7664.308 m
    Marspec Distance to Shore 6.0 km
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    GEOMACS - geometric mean 6.314495 Pascals
    Marspec Annual Range in Sea Surface Salinity 0.38 100 x psu
    Marspec Annual Range in Sea Surface Temperature 4.6 100 x degrees C
    Marspec Annual Variance in Sea Surface Salinity 1.56 100 x psu
    Marspec Annual Variance in Sea Surface Temperature 2.4645998 10,000 x degrees C
    Marspec Bathymetric Slope 0.1 10 x degrees
    Marspec Concavity 0.006 1000 x degrees
    Marspec East/West Aspect -0.51 radians
    Marspec Maximum Monthly Sea Surface Salinity 35.69 100 x psu
    Marspec Mean Annual Sea Surface Salinity 35.489998 100 x psu
    Marspec Mean Annual Sea Surface Temperature 20.25 100 x degrees C
    Marspec Minimum Monthly Sea Surface Salinity 35.309998 100 x psu
    Marspec North/South Aspect -0.84999996 1 x radians
    Marspec Plan Curvature 1.0E-4 x 10000
    Marspec Profile Curvature -4.0E-4 x 10000
    Marspec Sea Surface Temperature of the coldest ice-free month 17.869999 100 x degrees C
    Marspec Sea Surface Temperature of the warmest ice-free month 22.47 100 x degrees C
    Sea Surface Temperature - MODIS Terra 20.320532 Degrees C
    SeaWIFS K490 Mean 0.08188254 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.60207665 mg/m^3
    Topography
    Averaged Topographic Relief 42.5 metres
    Bathymetry and Elvation 9 sec -16.0 m
    Topographic Slope (degrees) 0.44833362 degrees