Occurrence record: BOLD - Australian records - 3754952

GenomicDNA of COLEOPTERA | Beetles recorded on 2009-12-02

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3754952
Other catalogue numbers recordID:1667226;ProcessID:MSAC719-10;sampleID:PL1032I
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Lang, P.J.
Supplied as "P.J.Lang"
Sex male
Life stage adult
License CC-BY-Int
Field number PL1032I
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Peter J. Lang

Event

Field number PL1032I
Record date 2009-12-02
Date precision Day

Taxonomy

Scientific name COLEOPTERA
Taxon rank order
Common name Beetles
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Coleoptera
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory South Australia
Local government area Goyder (DC)
Locality 0.45 km ESE Webb Gap
Latitude -33.98
Longitude 138.965
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HQ965678
markercode COI-5P
nucleotides AACGCTTTATTTTATTTTTGGTGCCTGATCCGGAATAGTGGGAACTGCTCTAAGTCTATTAATCCGAGCAGAATTAGGTAACCCTGGAGCCTTAATTGGAGATGATCAAATTTACAATGTTATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCCATTATAATGGGTGGATTTGGGAATTGATTAGTACCCTTAATATTAGGAGCACCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCTTTAACACTTTTATTGATAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGTTGAACTGTATACCCGCCACTGGCGGCTAATGTGGCCCATAGAGGAGCCTCAGTCGACTTAGCTATTTTTAGACTACATTTAGCAGGAATTTCCTCTATTCTTGGAGCAGTAAATTTTATTACAACTGTAATTAATATACGATCTGTTGGTATAACTTTTGACCGAATACCTTTATTTGTCTGATCAGTAGCTATTACCGCCCTTCTACTTCTTCTATCTCTCCCAGTTTTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAACCTTAATACATCATTCTTTGACCCAGCTGGAGGGGGGGATCCTATTCTTTACCAACACTTATTT
owner institution code Research Collection of Peter J. Lang
sequence last updated 2011-11-14T08:11:44Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    CAPAD 2010 Terrestrial Unnamed (No.HA669)
    CAPAD 2012 Terrestrial Unnamed (No.HA669)
    CAPAD 2014 Terrestrial Unnamed (No.HA669)
    CAPAD 2016 Terrestrial Unnamed (No.HA669)
    Fallow practice - dominant (area) Fallow less than 3 months
    Fallow practice - dominant (number) Fallow 3-9 months
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Global 200 priority ecoregions - Terrestrial Southern Australia Mallee and Woodlands
    Irrigation practice - dominant 6. Local knowledge
    Land use Other minimal uses
    Murray Darling Basin Authority Water Quality Zones Lower
    Murray-Darling Basin Boundary Murray-Darling Basin Boundary
    Murray-Darling Basin Ground Water Plan Areas GW4
    Murray-Darling Basin Ground Water Plan Areas (2018) South Australian Murray Region
    Murray-Darling Basin Ground Water SDL Resource Units SA Murray (GS6)
    Murray-Darling Basin Ground Water SDL Resource Units (2018) SA Murray (GS6)
    Murray-Darling Basin Surface Water Plan Areas SW5
    Murray-Darling Basin Surface Water Plan Areas (2019) South Australian Murray Region
    Murray-Darling Basin Surface Water SDL Resource Units SS10
    Murray-Darling Basin Surface Water SDL Resource Units (2019) South Australian Non-Prescribed Areas
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Valleys LOWER MURRAY
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Zones mt lofty
    NRM Regions 2010 South Australian Murray Darling Basin
    NRM Regions 2014 South Australian Murray Darling Basin
    NRM Regions 2015 South Australian Murray Darling Basin
    NRM Regions 2017 South Australian Murray Darling Basin
    NRM Regions 2017 (Qld 2019) South Australian Murray Darling Basin
    Stubble practice - dominant (area) Stubble left intact
    Stubble practice - dominant (number) Removed by hot burn
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 South Australian Murray Darling Basin
    Biodiversity
    Freshwater Ecoregions of the World Murray - Darling
    IBRA 6 Regions Flinders Lofty Block
    IBRA 6 Sub Regions Broughton
    IBRA 7 Regions Flinders Lofty Block
    IBRA 7 Subregions Broughton
    Terrestrial Ecoregional Boundaries Tirari-Sturt Stony Desert
    World Anthropogenic Biomes (2000) Remote croplands
    Climate
    Agroclimatic classification of Australia "Mediterranean" climate, but with drier cooler winters and less growth than Classic "Mediterranean" climate
    Koppen Climate Classification (All Classes) Temperate: no dry season (warm summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Pasture, cropland (temperate)
    Hydrology
    Drainage Divisions Level 1 Murray-Darling Basin
    Drainage Divisions Level 2 DARLING RIVER
    River Regions LOWER MURRAY RIVER
    Marine
    Marine Ecoregions of the World South Australian Gulfs
    States including coastal waters South Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories South Australia
    Australian States and Territories South Australia
    Commonwealth Electoral Boundaries Grey
    Local Government Areas 2011 Goyder (DC)
    Local Government Areas 2012 deprecated Goyder
    Local Government Areas PSMA 2018 THE REGIONAL COUNCIL OF GOYDER
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water Maraura, Ngarrindjeri, Ngintait
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water (2019) First Peoples of the South East, Maraura, Ngaduri, Ngarrindjeri, Ngintait, Peramangk, RMMAC
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water Ngarrindjeri, Ngintait
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water (2019) First Peoples of the South East, Maraura, Ngaduri, Ngarrindjeri, Ngintait, RMMAC
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 54
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 1203
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF SA
    PSMA ABS SA2 Statistical Areas (2016) GOYDER
    PSMA ABS SA3 Statistical Areas (2016) LOWER NORTH
    PSMA ABS SA4 Statistical Areas (2016) BAROSSA - YORKE - MID NORTH
    PSMA Commonwealth Electoral Boundaries (2016) GREY
    PSMA Commonwealth Electoral Boundaries (2018) GREY
    PSMA Indigenous Areas (2016) FLINDERS
    PSMA Indigenous Locations (2016) FLINDERS RANGES
    PSMA Indigenous Regions (2016) PORT AUGUSTA
    PSMA Localities (2018) BRADY CREEK
    PSMA Remoteness Areas (2016) Outer Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (SA)
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) STUART
    PSMA States (2016) SOUTH AUSTRALIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (SA)
    PSMA Wards (2018) ROBERTSTOWN WARD
    Statistical Local Areas Goyder (DC)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Adelaide Region
    Surface Geology of Australia Nsuu
    Topography
    Physiographic Provinces of Australia Gulfs Ranges Province
    Physiographic Regions 2011 Flinders-Lofty Ranges
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Native forest
    Forests of Australia (2013) v2.0 Eucalypt Low Woodland
    Land cover Annual crops and highly modified pastures
    NVIS 4.1 Major Vegetation Groups Eucalypt Woodlands
    NVIS 4.1 Major Vegetation Subgroups Eucalyptus woodlands with a shrubby understorey
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Replaced
    Vegetation types - native Eucalypt woodlands
    Vegetation types - present Eucalyptus woodlands

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 1.9309238E7 $
    Area management
    Phosphorus 0.01869137 t/ha
    Potassium 0.03901846 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.7604
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.8347
    Endemism 0.0027974595
    Endemism (Non-marine) 0.0029547673
    Mammals – Fritz et al 2009 - 0.5 degree 0.2691
    Migratory species (2008) 4.0 frequency
    Occurrence Density 6661.0 frequency
    Shannon Diversity (H) 5.901633 index
    Species Richness 807.0 frequency
    Threatened communities (2008) 2.0 frequency
    Threatened species (2008) 8.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.43135756
    2030A1BMk35M: Evaporation - month min 46.45 mm
    2030A1BMk35M: Precipitation - annual mean 36.923332 mm
    2030A1BMk35M: Precipitation - driest month 16.78 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.5923567
    2030A1BMk35M: Precipitation - spring or autumn season 0.5854512
    2030A1BMk35M: Temperature - annual max mean 21.269167 degrees C
    2030A1BMk35M: Temperature - annual min mean 8.796667 degrees C
    2030A1BMk35M: Temperature - annual range 25.73999 degrees C
    Aridity index - annual mean 0.5534704
    Aridity index - month max 1.3783665
    Aridity index - month min 0.098182686
    Evaporation - annual mean 132.05289 (ml/5km x 5km pixel)
    Evaporation - average 11163.0 ml
    Evaporation - month max 255.85515 mm
    Evaporation - month min 39.805126 mm
    Evaporation - variability 13.0 %
    Growth index C3 macrotherm plants - annual mean 0.03 index
    Growth index C3 mesotherm plants - annual mean 0.17 index
    Growth index C4 megatherm plants - annual mean 0.02 index
    Humidity - annual mean relative 77.29134 %
    Humidity - annual mean relative 3pm 64.09633 %
    Humidity - month max relative 91.95593 %
    Humidity - month max relative 3pm 79.70902 %
    Humidity - month min relative 48.846886 %
    Humidity - month min relative 3pm 48.846886 %
    Precipitation - annual 497.0 mm
    Precipitation - annual (Bio12) 510.0 mm
    Precipitation - annual mean 41.644806 mm
    Precipitation - annual seasonality -0.8413314
    Precipitation - coldest quarter (Bio19) 196.0 mm
    Precipitation - driest month 19.154951 mm
    Precipitation - driest period (Bio14) 4.0 mm
    Precipitation - driest quarter (Bio17) 64.0 mm
    Precipitation - equinox seasonality ratio 1.2570394
    Precipitation - seasonality (Bio15) 43.0 mm
    Precipitation - spring or autumn season 0.25467825
    Precipitation - warmest quarter (Bio18) 68.0 mm
    Precipitation - wettest month 64.309906 mm
    Precipitation - wettest period (Bio13) 16.0 mm
    Precipitation - wettest quarter (Bio16) 196.0 mm
    Radiation - annual mean (Bio20) 17.8 MJ/m2/day
    Radiation - seasonality (Bio23) 40.0
    Radiation - warmest quarter (Bio26) 25.9 MJ/m2/day
    Temperature - annual max mean 19.575 degrees C
    Temperature - annual mean (Bio01) 14.0 degrees C
    Temperature - annual min mean 7.1508336 degrees C
    Temperature - annual range 24.799988 degrees C
    Temperature - annual range (Bio07) 25.9 degrees C
    Temperature - coldest month min 2.91 degrees C
    Temperature - coldest period min (Bio06) 3.3 degrees C
    Temperature - coldest quarter mean (Bio11) 8.2 degrees C
    Temperature - diurnal range mean (Bio02) 12.3 degrees C
    Temperature - driest quarter mean (Bio09) 19.4 degrees C
    Temperature - isothermality (Bio03) 0.47 %
    Temperature - month hottest maximum 27.94 degrees C
    Temperature - seasonality (Bio04) 1.64
    Temperature - warmest month min 12.31 degrees C
    Temperature - warmest period max (Bio05) 29.1 degrees C
    Temperature - warmest quarter (Bio10) 20.1 degrees C
    Temperature - wettest quarter mean (Bio08) 8.3 degrees C
    Wind run - annual mean 197.00235 km/day
    WorldClim: Precipitation - annual 543.0 mm
    WorldClim: Precipitation - coldest quarter 203.0 mm
    WorldClim: Precipitation - driest month 21.0 mm
    WorldClim: Precipitation - driest quarter 67.0 mm
    WorldClim: Precipitation - seasonality 42.0
    WorldClim: Precipitation - warmest quarter 67.0 mm
    WorldClim: Precipitation - wettest month 72.0 mm
    WorldClim: Precipitation - wettest quarter 206.0 mm
    WorldClim: Temperature - annual mean 139.0 degrees C * 10
    WorldClim: Temperature - annual range 259.0 degrees C * 10
    WorldClim: Temperature - coldest month min 29.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 80.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 130.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 198.0 degrees C * 10
    WorldClim: Temperature - isothermality 50.0 %
    WorldClim: Temperature - seasonality 4692.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 288.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 199.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 86.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.81939 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.15811388 km
    Euclidean Distance to Coast (metres) 61616.316 m
    Remoteness index 3.9539862
    Hydrology
    Drainage - average 592.0 megalitres/5x5km/year
    Drainage - variability 102.0 %
    Runoff - average 140.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 0.3455032 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 80.42486
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 46.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.49 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 24.0 %
    Bulk density 1.6181482 Mg/m^3
    Carbon - organic 1.1563565 %
    Clay % 34.73148 %
    Hydrologic conductivity - average saturated 17.5 mm/h
    Moisture Index - annual mean (Bio28) 0.48
    Moisture Index - highest quarter mean (Bio32) 0.93
    Nutrient status 1.0 index
    Ph - soil 6.0 ph
    Soil depth 0.9 m
    Soil pedality 2.8209877
    Water holding capacity 24000.0 mm
    Water stress index - month max 81.0
    Weathering Intensity V2 3.80362 Weathering Intensity Index
    Topography
    Aspect 89.0 degrees
    Averaged Topographic Relief 188.29167 metres
    Bathymetry and Elvation 9 sec 597.0 m
    Elevation 571.0 m
    Topographic Slope (degrees) 8.765547 degrees
    Topographic relief 94.89355 m
    Topographic slope (%) 6.406787 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.2404 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 35.0 %
    Fractional Cover - Bare Soil (2012-03-05) 20.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 42.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 39.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0123 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.6 m^2 plant / m^2 ground
    NDVI Mean 52.0 NDVI x 100
    NPP Mean 4.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.5081 NDVI