We have just released new data filter features to improve the way you search and filter data in the ALA. There is now a default data filter in place that excludes lower quality records. You can pre-filter your search results using a suite of other data filters. To learn more, read Getting started with the data profiles.

Occurrence record: BOLD - Australian records - 3377863

GenomicDNA of COLEOPTERA | Beetles recorded on 2004-06-15

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3377863
Other catalog numbers recordID:1231278;ProcessID:MSAC271-09;sampleID:ENWL005
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector Hudson, P.
Supplied as "P. Hudson"
Sex female
Life stage adult
License CC-BY-Int
Field number ENWL005
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Peter Hudson

Event

Field number ENWL005
Occurrence date 2004-06-15
Date precision Day

Taxonomy

Scientific name COLEOPTERA
Taxon rank order
Common name Beetles
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Coleoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory South Australia
Locality Unincorporated SA
Locality EAST of NORTH WELL LAKE
Latitude -30.8733
Longitude 135.453
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HQ575449
markercode COI-5P
nucleotides AACATTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGAACTTCATTAAGAATATTAATTCGAGCTGAATTAGGAAATCCTGGATCATTAATTGGAGATGATCAAATTTACAATGTTATTGTAACTGCACATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATTTTAATTGGTGGATTTGGAAATTGATTAGTTCCTTTAATACTTGGAGCCCCAGATATAGCATTTCCCCGAATAAATAATATAAGCTTTTGACTTCTTCCTCCTTCATTAACATTACTTTTAATAAGTAGAATGGTAGAAAGAGGAGCCGGAACAGGATGAACTGTTTATCCACCATTATCTTCAGTAATTGCTCATAGAGGAGCTTCAGTAGATTTAGCTATTTTTAGTCTTCATTTAGCAGGAGTATCATCAATTTTAGGAGCTGTAAATTTTATTACAACTATTATTAATATACGATCAATTGGAATAACATTTGATCGAATACCATTATTTGTTTGATCTGTAGGAATTACAGCATTATTGTTATTATTATCATTACCAGTATTAGCGGGAGCAATTACAATACTTTTAACTGATCGAAATTTAAATACTTCTTTTTTTGACCCGGCTGGAGGTGGAGATCCTATTTTATATCAACACTTATTT
Owner institution code Research Collection of Peter Hudson
sequence last updated 2011-11-14T08:11:44Z

User flagged issues 

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Bush Heritage Reserves April 2015 Bon Bon Station
    CAPAD 2012 Terrestrial Bon Bon
    CAPAD 2014 Terrestrial Bon Bon
    CAPAD 2016 Terrestrial Bon Bon Station
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Important Bird Areas (IBA) Australia Bulgunnia IBA
    Irrigation practice - dominant No irrigation
    Land use Grazing of native pastures
    NRM Regions 2010 South Australian Arid Lands
    NRM Regions 2014 South Australian Arid Lands
    NRM Regions 2015 South Australian Arid Lands
    NRM Regions 2017 South Australian Arid Lands
    NRM Regions 2017 (Qld 2019) South Australian Arid Lands
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 South Australian Arid Lands
    Biodiversity
    Freshwater Ecoregions of the World Paleo
    IBRA 6 Regions Gawler
    IBRA 6 Sub Regions Kingoonya
    IBRA 7 Regions Gawler
    IBRA 7 Subregions Kingoonya
    Terrestrial Ecoregional Boundaries Tirari-Sturt Stony Desert
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Semi-arid climate that is too dry to support field crops. Soil moisture tends to be greatest in winter
    Koppen Climate Classification (All Classes) Desert: hot (persistently dry)
    Koppen Climate Classification (Major Classes) Desert
    Fire
    Fire regime niches Chenopod shrubland (semi-arid/arid)
    Hydrology
    Drainage Divisions Level 1 South Western Plateau
    Drainage Divisions Level 2 GAIRDNER
    River Regions GAIRDNER
    Marine
    Marine Ecoregions of the World South Australian Gulfs
    States including coastal waters South Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories South Australia
    Australian States and Territories South Australia
    Commonwealth Electoral Boundaries Grey
    Indigenous Land Use Agreements Antakirinja Area Minerals Exploration ILUA
    Local Government Areas 2011 Unincorporated SA
    Local Government Areas 2012 deprecated Unincorp. Far North
    Local Government Areas PSMA 2018 PASTORAL UNINCORPORATED AREA
    National Native Title Register (NNTR, Determinations of Native Title) - boundaries and core attributes Antakirinja Matu-Yankunytjatjara
    Native Title Determinations (13/7/2020) Antakirinja Matu-Yankunytjatjara SCD2011/001
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 73
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 505
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF SA
    PSMA ABS SA2 Statistical Areas (2016) OUTBACK
    PSMA ABS SA3 Statistical Areas (2016) OUTBACK - NORTH AND EAST
    PSMA ABS SA4 Statistical Areas (2016) SOUTH AUSTRALIA - OUTBACK
    PSMA Commonwealth Electoral Boundaries (2016) GREY
    PSMA Commonwealth Electoral Boundaries (2018) GREY
    PSMA Indigenous Areas (2016) EYRE
    PSMA Indigenous Locations (2016) LAKE EYRE - LAKE TORRENS
    PSMA Indigenous Regions (2016) PORT AUGUSTA
    PSMA Localities (2018) BON BON
    PSMA Remoteness Areas (2016) Very Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (SA)
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) GILES
    PSMA States (2016) SOUTH AUSTRALIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (SA)
    Statistical Local Areas Unincorp. Far North
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Eromanga Region
    Surface Geology of Australia Qdlu
    Topography
    Physiographic Provinces of Australia Eyre Peninsula Province
    Physiographic Regions 2011 Gairdner Plain
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Other special rights, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    IGBP Land Cover vegetation classification scheme (2011) Open shrublands
    Land cover Native grasslands and minimally modified pastures
    NVIS 4.1 Major Vegetation Groups Acacia Open Woodlands
    NVIS 4.1 Major Vegetation Subgroups Mulga (Acacia aneura) open woodlands and sparse shrublands +/- tussock grass
    Tenure of Australia's forests (2013) v2.0 Leasehold
    Vegetation - condition Residual
    Vegetation types - native Acacia shrublands
    Vegetation types - present Acacia shrublands

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 1911830.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.4126
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 0.0
    Endemism 0.0028031752
    Endemism (Non-marine) 0.0028104603
    Mammals – Fritz et al 2009 - 0.5 degree 0.2691
    Migratory species (2008) 2.0 frequency
    Occurrence Density 152.0 frequency
    Shannon Diversity (H) 2.9830418 index
    Species Richness 55.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 1.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.066326484
    2030A1BMk35M: Evaporation - month min 91.46 mm
    2030A1BMk35M: Precipitation - annual mean 12.798333 mm
    2030A1BMk35M: Precipitation - driest month 5.26 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.5252157
    2030A1BMk35M: Precipitation - spring or autumn season 0.5083495
    2030A1BMk35M: Temperature - annual max mean 28.135 degrees C
    2030A1BMk35M: Temperature - annual min mean 13.1925 degrees C
    2030A1BMk35M: Temperature - annual range 30.459991 degrees C
    Aridity index - annual mean 0.07437318
    Aridity index - month max 0.1764706
    Aridity index - month min 0.032207653
    Evaporation - annual mean 233.83365 (ml/5km x 5km pixel)
    Evaporation - average 4044.0 ml
    Evaporation - month max 403.6308 mm
    Evaporation - month min 85.0 mm
    Evaporation - variability 33.0 %
    Growth index C3 macrotherm plants - annual mean 0.02 index
    Growth index C3 mesotherm plants - annual mean 0.05 index
    Growth index C4 megatherm plants - annual mean 0.02 index
    Humidity - annual mean relative 69.324524 %
    Humidity - annual mean relative 3pm 51.670544 %
    Humidity - month max relative 87.936516 %
    Humidity - month max relative 3pm 66.659355 %
    Humidity - month min relative 40.69771 %
    Humidity - month min relative 3pm 40.69771 %
    Precipitation - annual 159.0 mm
    Precipitation - annual (Bio12) 172.0 mm
    Precipitation - annual mean 13.416667 mm
    Precipitation - annual seasonality 0.17333333
    Precipitation - coldest quarter (Bio19) 44.0 mm
    Precipitation - driest month 8.0 mm
    Precipitation - driest period (Bio14) 1.0 mm
    Precipitation - driest quarter (Bio17) 33.0 mm
    Precipitation - equinox seasonality ratio 1.0263158
    Precipitation - seasonality (Bio15) 26.0 mm
    Precipitation - spring or autumn season 0.025641026
    Precipitation - warmest quarter (Bio18) 43.0 mm
    Precipitation - wettest month 18.0 mm
    Precipitation - wettest period (Bio13) 5.0 mm
    Precipitation - wettest quarter (Bio16) 52.0 mm
    Radiation - annual mean (Bio20) 20.3 MJ/m2/day
    Radiation - seasonality (Bio23) 33.0
    Radiation - warmest quarter (Bio26) 27.5 MJ/m2/day
    Temperature - annual max mean 25.969168 degrees C
    Temperature - annual mean (Bio01) 19.4 degrees C
    Temperature - annual min mean 11.151667 degrees C
    Temperature - annual range 30.399994 degrees C
    Temperature - annual range (Bio07) 30.9 degrees C
    Temperature - coldest month min 4.46 degrees C
    Temperature - coldest period min (Bio06) 4.8 degrees C
    Temperature - coldest quarter mean (Bio11) 12.2 degrees C
    Temperature - diurnal range mean (Bio02) 14.7 degrees C
    Temperature - driest quarter mean (Bio09) 19.9 degrees C
    Temperature - isothermality (Bio03) 0.48 %
    Temperature - month hottest maximum 34.39 degrees C
    Temperature - seasonality (Bio04) 1.92
    Temperature - warmest month min 17.7 degrees C
    Temperature - warmest period max (Bio05) 35.7 degrees C
    Temperature - warmest quarter (Bio10) 26.5 degrees C
    Temperature - wettest quarter mean (Bio08) 22.0 degrees C
    Wind run - annual mean 222.62575 km/day
    WorldClim: Precipitation - annual 169.0 mm
    WorldClim: Precipitation - coldest quarter 42.0 mm
    WorldClim: Precipitation - driest month 11.0 mm
    WorldClim: Precipitation - driest quarter 38.0 mm
    WorldClim: Precipitation - seasonality 16.0
    WorldClim: Precipitation - warmest quarter 40.0 mm
    WorldClim: Precipitation - wettest month 20.0 mm
    WorldClim: Precipitation - wettest quarter 47.0 mm
    WorldClim: Temperature - annual mean 192.0 degrees C * 10
    WorldClim: Temperature - annual range 300.0 degrees C * 10
    WorldClim: Temperature - coldest month min 51.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 121.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 148.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 230.0 degrees C * 10
    WorldClim: Temperature - isothermality 49.0 %
    WorldClim: Temperature - seasonality 5413.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 351.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 260.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 128.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.03 degrees
    Distance - to coast 2.05061 km x 100
    Distance - to non-permanent water (weighted) 0.03 degrees
    Distance - to permanent water (weighted) 0.9935794 km
    Euclidean Distance to Coast (metres) 181152.05 m
    Remoteness index 16.018564
    Hydrology
    Drainage - average 8.0 megalitres/5x5km/year
    Drainage - variability 262.0 %
    Runoff - average 57.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 0.0 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 15.793789
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 80.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.37 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 21.0 %
    Bulk density 1.4691516 Mg/m^3
    Carbon - organic 0.0988912 %
    Clay % 30.143501 %
    Hydrologic conductivity - average saturated 65.0 mm/h
    Moisture Index - annual mean (Bio28) 0.08
    Moisture Index - highest quarter mean (Bio32) 0.16
    Nutrient status 1.2 index
    Ph - soil 8.0 ph
    Soil depth 0.7 m
    Soil pedality 2.4709387
    Water holding capacity 46000.0 mm
    Water stress index - month max 15.882352
    Weathering Intensity V2 5.18887 Weathering Intensity Index
    Topography
    Aspect 75.0 degrees
    Averaged Topographic Relief 14.375 metres
    Bathymetry and Elvation 9 sec 139.0 m
    Elevation 138.0 m
    Topographic Slope (degrees) 0.0 degrees
    Topographic relief 1.826172 m
    Topographic slope (%) 0.1201805 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.1261 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 13.0 %
    Fractional Cover - Bare Soil (2012-03-05) 34.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 64.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 1.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0033 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.2 m^2 plant / m^2 ground
    NDVI Mean 12.0 NDVI x 100
    NPP Mean 2.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.1944 NDVI