Occurrence record: BOLD - Australian records - 3744943

Material Sample of ANURA Fischer von Waldheim, 1813 | Bakuŋbakuŋ recorded on 2007-06-01
   API

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3744943
Other catalog numbers ["recordID:1541428;ProcessID:WAMAM134-10;sampleID:WAMR167732"]
Record type Material Sample
Supplied basis "MaterialSample"
Collector 1.  Doughty, P.   2.  Stevenson, C.A.  
Supplied as "P. Doughty, C.A. Stevenson"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Presence/Absence PRESENT
Identification ID Paul Doughty

Event

Occurrence date 2007-06-01
Date precision DAY

Taxonomy

Scientific name ANURA
Identified to rank order
Common name Bakuŋbakuŋ
Kingdom Animalia
Phylum Chordata
Class Amphibia
Order Anura
Name match metric exactMatch
Scientific name authorship Fischer von Waldheim, 1813
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Western Australia
Locality Mitchell Plateau
Latitude -14.8202
Supplied as: "-14.8202"
Longitude 125.721
Supplied as: "125.721"
Datum EPSG:4326
Coordinate precision Unknown
Terrestrial true
Biome TERRESTRIAL
Marine false
Country Code AU

Additional properties

genbank accession HQ987258
markercode COI-5P
nucleotides AACCCTCTATCTCGTCTTCGGTGCATGAGCCGGCATGGTCGGCACCGCCCTTAGCCTCCTTATCCGCGCCGAGCTGAGTCAACCCGGGTCACTTTTAGGTGACGATCAAATCTACAATGTAATCGTTACCGCACACGCATTTGTTATAATCTTTTTCATGGTTATGCCCGTAATAATCGGCGGTTTTGGCAACTGACTTGTCCCATTAATAATTGGTGCCCCAGACATAGCCTTCCCACGAATAAACAACATGAGCTTCTGACTTCTGCCACCTTCCTTTCTGCTCCTCCTAGCCTCGTCAGGTGTCGAGGCGGGGGTTGGCACGGGCTGAACAGTCTACCCGCCCCTAGCTAGCAACCTAGCCCACGCTGGACCATCAGTAGATCTCGCAATTTTCTCTCTGCATCTTGCCGGTGTCTCCTCGATTCTAGGGGCAATCAATTTTATTACTACAACACTAAATATAAAACCCCCCTCAATAACACAATATCAAACGCCCTTGTTCGTCTGATCAGTCCTAATTACAGCCGTTCTCCTACTCCTTTCCTTGCCTGTTCTTGCAGCGGGAATTACCATGCTTCTCACGGACCGCAACTTAAACACAACCTTTTTTGACCCCGCAGGGGGAGGAGACCCGGTCCTCTATCAACACCTATTT
Owner institution code Western Australian Museum
sequence last updated 2011-11-14T08:11:02Z

User flagged issues 

    Data quality tests

    Test name Result
    Coordinate uncertainty meters invalid Warning
    First of the month Warning
    Geodetic datum assumed WGS84 Warning
    Name not supplied Warning
    Show/Hide 73 passed properties
    Show/Hide 7 missing properties
    Show/Hide 30 tests that have not been run

    Additional political boundaries information

    Area Management
    CAPAD 2016 Terrestrial Mitchell River
    CAPAD 2020 Terrestrial Mitchell River
    NRM Regions 2010 Rangelands
    NRM Regions 2017 Rangelands Region
    Area management
    National Landcare Program Management Units 2018 Rangelands Region
    Biodiversity
    IBRA 6 Regions Northern Kimberley
    IBRA 7 Regions Northern Kimberley
    IBRA 7 Subregions Mitchell
    Hydrology
    Drainage Divisions Level 1 Tanami-Timor Sea Coast
    Drainage Divisions Level 2 KING EDWARD RIVER
    Land Management
    Western Australian Biodiversity Science Research Priority Regions Kimberley
    Marine
    States including coastal waters Western Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories Western Australia
    Australian States and Territories Western Australia
    Local Government Areas 2011 Wyndham-East Kimberley (S)
    Local Government Areas 2012 deprecated Wyndham-East Kimberley
    Local Government Areas PSMA 2018 SHIRE OF WYNDHAM-EAST KIMBERLEY
    National Native Title Register (NNTR, Determinations of Native Title) - boundaries and core attributes Uunguu Part A
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 108
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 270
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF WA
    PSMA ABS SA2 Statistical Areas (2016) KUNUNURRA
    PSMA ABS SA3 Statistical Areas (2016) KIMBERLEY
    PSMA ABS SA4 Statistical Areas (2016) WESTERN AUSTRALIA - OUTBACK (NORTH)
    PSMA Commonwealth Electoral Boundaries (2018) DURACK
    PSMA Indigenous Areas (2016) NORTH KIMBERLEY
    PSMA Indigenous Locations (2016) NORTH-WEST KIMBERLEY
    PSMA Indigenous Regions (2016) KUNUNURRA
    PSMA Remoteness Areas (2016) Very Remote Australia
    PSMA State Electoral Boundaries (2018) KIMBERLEY, MP
    PSMA States (2016) WESTERN AUSTRALIA
    World Country Boundaries Australia
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Other special rights, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Forests of Australia 2018B Eucalypt Medium Woodland
    NVIS 4.1 Major Vegetation Groups Tropical Eucalypt Woodlands/Grasslands
    NVIS 4.1 Major Vegetation Subgroups Tropical Eucalyptus forest and woodlands with a tall annual grassy understorey
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve
    Vegetation types - native Eucalypt woodlands
    Vegetation types - present Eucalyptus woodlands

    Environmental sampling for this location

    Climate
    Precipitation - annual (Bio12) 1331.0 mm
    Precipitation - coldest quarter (Bio19) 14.0 mm
    Precipitation - driest period (Bio14) 0.0 mm
    Precipitation - driest quarter (Bio17) 11.0 mm
    Precipitation - seasonality (Bio15) 115.0 mm
    Precipitation - warmest quarter (Bio18) 373.0 mm
    Precipitation - wettest period (Bio13) 80.0 mm
    Precipitation - wettest quarter (Bio16) 931.0 mm
    Radiation - annual mean (Bio20) 21.6 MJ/m2/day
    Radiation - seasonality (Bio23) 11.0
    Radiation - warmest quarter (Bio26) 23.8 MJ/m2/day
    Temperature - annual mean (Bio01) 26.4 degrees C
    Temperature - annual range (Bio07) 24.7 degrees C
    Temperature - coldest period min (Bio06) 11.9 degrees C
    Temperature - coldest quarter mean (Bio11) 22.1 degrees C
    Temperature - diurnal range mean (Bio02) 13.8 degrees C
    Temperature - driest quarter mean (Bio09) 22.4 degrees C
    Temperature - isothermality (Bio03) 0.56 %
    Temperature - seasonality (Bio04) 0.98
    Temperature - warmest period max (Bio05) 36.6 degrees C
    Temperature - warmest quarter (Bio10) 29.5 degrees C
    Temperature - wettest quarter mean (Bio08) 28.3 degrees C
    WorldClim 2.1: Temperature - annual mean 26.733334 °C
    WorldClim: Temperature - isothermality 57.0 %
    Substrate
    Moisture Index - annual mean (Bio28) 0.47
    Moisture Index - highest quarter mean (Bio32) 1.0
    Elevation 189.0 m