Occurrence record: BOLD - Australian records - 3763091

GenomicDNA of LEPIDOPTERA | Moths recorded on 1971-09-01

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3763091
Other catalogue numbers recordID:1645965;ProcessID:ANICE281-10;sampleID:10ANIC-01278
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
Collector/Observer Hodgson, J.
Supplied as "J.Hodgson"
License CC-BY-Int
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 1971-09-01
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Northern Territory
Local government area Central Desert (S)
Locality Wilson Creek
Latitude -19.08
Longitude 130.09
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HQ921326
markercode COI-5P
nucleotides AACATTATACTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACCTCTTTAAGATTATTAATTCGAGCTGAATTAGGAACTCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCCTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTTTTACCCCCCTCTTTAACCCTTTTAATTTCAAGAAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCACTCTCATCTAATATTGCCCATAGAGGTAGTTCAGTTGATTTAGCCATTTTTTCTCTACATTTAGCTGGAATCTCTTCAATTTTAGGCGCTATTAATTTTATTACAACAATTATCAATATACGATTAAATAATTTATTTTTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACAGCTTTCTTATTACTTCTTTCTTTACCTGTTTTAGCTGGTGCCATTACTATATTATTAACAGATCGTAATCTTAATACATCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:42Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    First of the month Warning
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the year Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 46 tests that have not been run

    Additional political boundaries information

    Area Management
    CAPAD 2010 Terrestrial Northern Tanami
    CAPAD 2012 Terrestrial Northern Tanami
    CAPAD 2014 Terrestrial Northern Tanami
    CAPAD 2016 Terrestrial Northern Tanami
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Global 200 priority ecoregions - Terrestrial Great Sandy-Tanami-Central Ranges Desert
    Irrigation practice - dominant No irrigation
    Land use Managed resource protected areas
    NRM Regions 2010 Northern Territory
    NRM Regions 2014 Northern Territory
    NRM Regions 2015 Northern Territory
    NRM Regions 2017 Northern Territory
    NRM Regions 2017 (Qld 2019) Northern Territory
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Northern Territory
    Biodiversity
    Freshwater Ecoregions of the World Paleo
    IBRA 6 Regions Tanami
    IBRA 6 Sub Regions Tanami P1
    IBRA 7 Regions Tanami
    IBRA 7 Subregions Tanami Desert
    Terrestrial Ecoregional Boundaries Great Sandy-Tanami Desert
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Desert, supporting very little plant growth due to water limitation
    Koppen Climate Classification (All Classes) Grassland: hot (winter drought)
    Koppen Climate Classification (Major Classes) Grassland
    Fire
    Fire regime niches Hummock grassland (semi-arid/arid)
    Hydrology
    Drainage Divisions Level 1 Tanami-Timor Sea Coast
    Drainage Divisions Level 2 VICTORIA RIVER-WISO
    River Regions VICTORIA RIVER-WISO
    Marine
    States including coastal waters Northern Territory (including Coastal Waters)
    Political
    ASGS Australian States and Territories Northern Territory
    Australian States and Territories Northern Territory
    Commonwealth Electoral Boundaries Lingiari
    Indigenous Protected Areas 2013 Northern Tanami
    Local Government Areas 2011 Central Desert (S)
    Local Government Areas 2012 deprecated Victoria
    Local Government Areas PSMA 2018 CENTRAL DESERT REGION
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 215
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 229
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF NT
    PSMA ABS SA2 Statistical Areas (2016) TANAMI
    PSMA ABS SA3 Statistical Areas (2016) ALICE SPRINGS
    PSMA ABS SA4 Statistical Areas (2016) NORTHERN TERRITORY - OUTBACK
    PSMA Commonwealth Electoral Boundaries (2016) LINGIARI
    PSMA Commonwealth Electoral Boundaries (2018) LINGIARI
    PSMA Indigenous Areas (2016) NYIRRIPI AND TANAMI OUTSTATIONS
    PSMA Indigenous Locations (2016) TANAMI OUTSTATIONS
    PSMA Indigenous Regions (2016) APATULA
    PSMA Localities (2018) GURINDJI
    PSMA Remoteness Areas (2016) Very Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (NT)
    PSMA State Electoral Boundaries (2016) STUART
    PSMA State Electoral Boundaries (2018) STUART
    PSMA States (2016) NORTHERN TERRITORY
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (NT)
    PSMA Wards (2018) NORTHERN TANAMI WARD
    Statistical Local Areas Central Desert (S)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Winnecke Region
    Surface Geology of Australia Qa
    Topography
    Physiographic Provinces of Australia Barkly-Tanami Plains Province
    Physiographic Regions 2011 Tanami Sandplain and Ranges
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Indigenous owned, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Native shrublands and heathlands
    NVIS 4.1 Major Vegetation Groups Eucalypt Open Woodlands
    NVIS 4.1 Major Vegetation Subgroups Eucalyptus low open woodlands with hummock grass
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Residual
    Vegetation types - native Eucalypt open woodlands
    Vegetation types - present Eucalyptus open woodlands

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 1.0309905E7 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.3367
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.3716
    Endemism 0.0021952025
    Endemism (Non-marine) 0.0022065076
    Mammals – Fritz et al 2009 - 0.5 degree 0.0
    Migratory species (2008) 2.0 frequency
    Occurrence Density 446.0 frequency
    Shannon Diversity (H) 4.474602 index
    Species Richness 122.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 1.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.1452238
    2030A1BMk35M: Evaporation - month min 145.42 mm
    2030A1BMk35M: Precipitation - annual mean 37.5875 mm
    2030A1BMk35M: Precipitation - driest month 0.1 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.6618733
    2030A1BMk35M: Precipitation - spring or autumn season -0.5012262
    2030A1BMk35M: Temperature - annual max mean 34.618336 degrees C
    2030A1BMk35M: Temperature - annual min mean 18.600834 degrees C
    2030A1BMk35M: Temperature - annual range 30.169983 degrees C
    Aridity index - annual mean 0.11919574
    Aridity index - month max 0.4346754
    Aridity index - month min 0.008755422
    Evaporation - annual mean 269.16388 (ml/5km x 5km pixel)
    Evaporation - average 10987.0 ml
    Evaporation - month max 349.4 mm
    Evaporation - month min 168.7 mm
    Evaporation - variability 31.0 %
    Growth index C3 macrotherm plants - annual mean 0.11 index
    Growth index C3 mesotherm plants - annual mean 0.03 index
    Growth index C4 megatherm plants - annual mean 0.1 index
    Humidity - annual mean relative 57.771767 %
    Humidity - annual mean relative 3pm 44.10515 %
    Humidity - month max relative 67.4356 %
    Humidity - month max relative 3pm 49.08882 %
    Humidity - month min relative 37.681313 %
    Humidity - month min relative 3pm 37.681313 %
    Precipitation - annual 415.0 mm
    Precipitation - annual (Bio12) 499.0 mm
    Precipitation - annual mean 34.75 mm
    Precipitation - annual seasonality 7.5227275
    Precipitation - coldest quarter (Bio19) 11.0 mm
    Precipitation - driest month 2.0 mm
    Precipitation - driest period (Bio14) 0.0 mm
    Precipitation - driest quarter (Bio17) 9.0 mm
    Precipitation - equinox seasonality ratio 0.7941176
    Precipitation - seasonality (Bio15) 121.0 mm
    Precipitation - spring or autumn season -0.267296
    Precipitation - warmest quarter (Bio18) 228.0 mm
    Precipitation - wettest month 116.0 mm
    Precipitation - wettest period (Bio13) 44.0 mm
    Precipitation - wettest quarter (Bio16) 351.0 mm
    Radiation - annual mean (Bio20) 22.6 MJ/m2/day
    Radiation - seasonality (Bio23) 14.0
    Radiation - warmest quarter (Bio26) 25.8 MJ/m2/day
    Temperature - annual max mean 32.7125 degrees C
    Temperature - annual mean (Bio01) 25.2 degrees C
    Temperature - annual min mean 16.84 degrees C
    Temperature - annual range 37.0 degrees C
    Temperature - annual range (Bio07) 30.6 degrees C
    Temperature - coldest month min 7.88 degrees C
    Temperature - coldest period min (Bio06) 7.9 degrees C
    Temperature - coldest quarter mean (Bio11) 18.1 degrees C
    Temperature - diurnal range mean (Bio02) 15.9 degrees C
    Temperature - driest quarter mean (Bio09) 18.7 degrees C
    Temperature - isothermality (Bio03) 0.52 %
    Temperature - month hottest maximum 38.03 degrees C
    Temperature - seasonality (Bio04) 1.68
    Temperature - warmest month min 23.06 degrees C
    Temperature - warmest period max (Bio05) 38.6 degrees C
    Temperature - warmest quarter (Bio10) 30.7 degrees C
    Temperature - wettest quarter mean (Bio08) 30.1 degrees C
    Wind run - annual mean 132.96274 km/day
    WorldClim: Precipitation - annual 448.0 mm
    WorldClim: Precipitation - coldest quarter 17.0 mm
    WorldClim: Precipitation - driest month 4.0 mm
    WorldClim: Precipitation - driest quarter 17.0 mm
    WorldClim: Precipitation - seasonality 96.0
    WorldClim: Precipitation - warmest quarter 204.0 mm
    WorldClim: Precipitation - wettest month 109.0 mm
    WorldClim: Precipitation - wettest quarter 276.0 mm
    WorldClim: Temperature - annual mean 254.0 degrees C * 10
    WorldClim: Temperature - annual range 299.0 degrees C * 10
    WorldClim: Temperature - coldest month min 85.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 184.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 156.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 184.0 degrees C * 10
    WorldClim: Temperature - isothermality 52.0 %
    WorldClim: Temperature - seasonality 4863.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 384.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 305.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 296.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 3.945757 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.6576473 km
    Euclidean Distance to Coast (metres) 382425.84 m
    Remoteness index 17.695562
    Fire
    Fire - time since last 5.0 years
    Fire frequency 4.0 frequency
    Hydrology
    Drainage - average 298.0 megalitres/5x5km/year
    Drainage - variability 159.0 %
    Runoff - average 1514.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 0.0 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 55.301064
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 142.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.3 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 5.0 %
    Bulk density 1.2659374 Mg/m^3
    Carbon - organic 0.08513704 %
    Clay % 6.6302085 %
    Hydrologic conductivity - average saturated 300.0 mm/h
    Moisture Index - annual mean (Bio28) 0.14
    Moisture Index - highest quarter mean (Bio32) 0.39
    Nutrient status 0.95 index
    Soil depth 0.9 m
    Soil pedality 1.80625
    Water holding capacity 50000.0 mm
    Water stress index - month max 39.120785
    Weathering Intensity V2 5.70039 Weathering Intensity Index
    Topography
    Aspect 163.0 degrees
    Averaged Topographic Relief 76.708336 metres
    Bathymetry and Topography 9 sec 410.0 m
    Elevation 415.0 m
    Topographic Slope (degrees) 0.7721326 degrees
    Topographic relief 10.31131 m
    Topographic slope (%) 0.6012401 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.1385 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 25.0 %
    Fractional Cover - Bare Soil (2012-03-05) 36.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 41.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 23.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0083 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.5 m^2 plant / m^2 ground
    NDVI Mean 31.0 NDVI x 100
    NPP Mean 2.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.3 NDVI