Occurrence record: BOLD - Australian records - 3978578

GenomicDNA of LEPIDOPTERA | Moths recorded on 2002-01-06

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3978578
Other catalog numbers recordID:1888111;ProcessID:ANICR1368-11;sampleID:11ANIC-03368
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Edwards|Horak|Sattler
Supplied as "Edwards,Horak,Sattler"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Field number 11ANIC-03368
Occurrence status present
Abcd identification qualifier Not provided

Event

Field number 11ANIC-03368
Record date 2002-01-06
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province New South Wales
Locality Tumbarumba (A)
Locality Dead Horse Gap
Latitude -36.31
Longitude 148.16
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession JN267358
markercode COI-5P
nucleotides AACATTATACTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACCTCTTTAAGACTATTAATTCGAGCAGAATTAGGAAATCCAGGATCATTAATTGGAGATGACCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTGGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCACCTTCAATCACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACTGGATGAACAGTTTACCCACCTTTATCTTCTAATATTGCTCATGGAGGAAGTTCAGTAGATTTAGCAATTTTTTCATTACACCTAGCTGGAATTTCATCAATTTTAGGGGCTATTAATTTTATTACAACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTTTTATTATTATTATCATTACCTGTGTTAGCTGGAGCTATTACCATATTACTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT
Owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:44Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    CAPAD 2010 Terrestrial Kosciuszko
    CAPAD 2012 Terrestrial Kosciuszko
    CAPAD 2014 Terrestrial Kosciuszko
    CAPAD 2016 Terrestrial Kosciuszko
    Fallow practice - dominant (area) Fallow 3-9 months
    Fallow practice - dominant (number) Fallow 3-9 months
    GER National Corridor GER National Corridor
    GER Slopes To Summit GER Slopes To Summit
    GER Standard Boundary GER Standard Boundary
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    Important Bird Areas (IBA) Australia Kosciuszko & Namadgi IBA
    Irrigation practice - dominant No irrigation
    Land use Nature conservation
    Murray Darling Basin Authority Water Quality Zones Upland
    Murray-Darling Basin Boundary Murray-Darling Basin Boundary
    Murray-Darling Basin Ground Water Plan Areas GW11
    Murray-Darling Basin Ground Water Plan Areas (2018) NSW Murray���Darling Basin Fractured Rock
    Murray-Darling Basin Ground Water SDL Resource Units Lachlan Fold Belt (GS20)
    Murray-Darling Basin Ground Water SDL Resource Units (2018) Lachlan Fold Belt MDB (GS20)
    Murray-Darling Basin Surface Water Plan Areas SW8
    Murray-Darling Basin Surface Water Plan Areas (2019) New South Wales Murray and Lower Darling
    Murray-Darling Basin Surface Water SDL Resource Units SS14
    Murray-Darling Basin Surface Water SDL Resource Units (2019) New South Wales Murray
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Valleys UPPER MURRAY
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Zones upland
    NRM Regions 2010 Murray
    NRM Regions 2014 Murray
    NRM Regions 2015 Murray
    NRM Regions 2017 Murray
    NRM Regions 2017 (Qld 2019) Murray
    Stubble practice - dominant (area) Stubble left intact
    Stubble practice - dominant (number) Stubble left intact
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 Murray
    Biodiversity
    Freshwater Ecoregions of the World Murray - Darling
    IBRA 6 Regions South Eastern Highlands
    IBRA 6 Sub Regions Bondo
    IBRA 7 Regions South Eastern Highlands
    IBRA 7 Subregions Bondo
    Terrestrial Ecoregional Boundaries Southeast Australia Temperate Forests
    World Anthropogenic Biomes (2000) Wild woodlands
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Koppen Climate Classification (All Classes) Temperate: no dry season (warm summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Eucalypt forest (temperate)
    National Indicative Aggregated Fire Extent Dataset 2019-2020 - v20200324 National Indicative Aggregated Fire Extent 2019-2020
    Hydrology
    Drainage Divisions Level 1 Murray-Darling Basin
    Drainage Divisions Level 2 DARLING RIVER
    River Regions UPPER MURRAY RIVER
    Marine
    Marine Ecoregions of the World Cape Howe
    States including coastal waters New South Wales (including Coastal Waters)
    Political
    ASGS Australian States and Territories New South Wales
    Australian States and Territories New South Wales
    Commonwealth Electoral Boundaries Riverina
    Local Government Areas 2011 Tumbarumba (A)
    Local Government Areas 2012 deprecated Tumbarumba
    Local Government Areas PSMA 2018 SNOWY VALLEYS COUNCIL
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water Barkindji, Gomeroi/Kamilaroi, Maljangapa, Ngiyampaa, Wailwan, Wiradjuri
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water (2019) Barkandji, Barapa Barapa, Bigambul, Budjiti, Euahlayi, Githabul, Gomeroi/Kamilaroi, Guwamu (Kooma), Kambuwal, Kunja, Kwiambul, Maljangapa, Maraura, Murrawarri, Mutthi Mutthi, Nari Nari, Ngarabal, Ngemba, Ngiyampaa, Nyeri Nyeri, Tati Tati, Wadi Wadi, Wail
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water Bangerang, Barkindji, Barapa Barapa, Maljangapa, Maraura, Muthi Muthi, Ngiyampaa, Nyeri Nyeri, Tati Tati, Wadi Wadi, Wamba Wamba, Weki Weki, Wiradjuri
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water (2019) Barkindji, Barapa Barapa, Maljangapa, Maraura, Mutthi Mutthi, Ngiyampaa, Nyeri Nyeri, Tati Tati, Wadi Wadi, Wemba Wemba, Weki Weki, Wiradjuri, Yorta Yorta
    NSW Local Land Services Regions Murray
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 6
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 795
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF NSW
    PSMA ABS SA2 Statistical Areas (2016) TUMBARUMBA
    PSMA ABS SA3 Statistical Areas (2016) TUMUT - TUMBARUMBA
    PSMA ABS SA4 Statistical Areas (2016) RIVERINA
    PSMA Commonwealth Electoral Boundaries (2016) EDEN-MONARO
    PSMA Commonwealth Electoral Boundaries (2018) EDEN-MONARO
    PSMA Indigenous Areas (2016) UPPER MURRAY
    PSMA Indigenous Locations (2016) UPPER MURRAY
    PSMA Indigenous Regions (2016) RIVERINA - ORANGE
    PSMA Localities (2018) KHANCOBAN
    PSMA Remoteness Areas (2016) Outer Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (NSW)
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) LEGISLATIVE COUNCIL
    PSMA States (2016) NEW SOUTH WALES
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (NSW)
    Statistical Local Areas Tumbarumba (A)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Lachlan Region
    Surface Geology of Australia Dgkc
    Topography
    Physiographic Provinces of Australia Kosciuszkan Uplands Province
    Physiographic Regions 2011 Australian Alps
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Native forest
    Forests of Australia (2013) v2.0 Eucalypt Medium Open
    Land cover Native forests and woodlands
    NVIS 4.1 Major Vegetation Groups Eucalypt Open Forests
    NVIS 4.1 Major Vegetation Subgroups Eucalyptus open forests with a grassy understorey
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve
    Vegetation - condition Residual
    Vegetation types - native Eucalypt open forests
    Vegetation types - present Eucalyptus open forest

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 1.4472747E7 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.5045
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.157
    Endemism 0.0058819554
    Endemism (Non-marine) 0.006168047
    Mammals – Fritz et al 2009 - 0.5 degree 0.3689
    Migratory species (2008) 5.0 frequency
    Occurrence Density 2309.0 frequency
    Shannon Diversity (H) 5.6760283 index
    Species Richness 547.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 3.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.8254563
    2030A1BMk35M: Evaporation - month min 37.18 mm
    2030A1BMk35M: Precipitation - annual mean 61.28583 mm
    2030A1BMk35M: Precipitation - driest month 44.59 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.3175492
    2030A1BMk35M: Precipitation - spring or autumn season 0.31546873
    2030A1BMk35M: Temperature - annual max mean 20.635 degrees C
    2030A1BMk35M: Temperature - annual min mean 6.9925003 degrees C
    2030A1BMk35M: Temperature - annual range 28.309998 degrees C
    Aridity index - annual mean 1.2643136
    Aridity index - month max 3.2947855
    Aridity index - month min 0.2775839
    Evaporation - annual mean 103.17951 (ml/5km x 5km pixel)
    Evaporation - average 21312.0 ml
    Evaporation - month max 208.94583 mm
    Evaporation - month min 26.04847 mm
    Evaporation - variability 11.0 %
    Growth index C3 macrotherm plants - annual mean 0.06 index
    Growth index C3 mesotherm plants - annual mean 0.29 index
    Growth index C4 megatherm plants - annual mean 0.04 index
    Humidity - annual mean relative 84.724884 %
    Humidity - annual mean relative 3pm 67.603165 %
    Humidity - month max relative 97.38667 %
    Humidity - month max relative 3pm 80.243126 %
    Humidity - month min relative 55.90707 %
    Humidity - month min relative 3pm 55.90707 %
    Precipitation - annual 875.0 mm
    Precipitation - annual (Bio12) 806.0 mm
    Precipitation - annual mean 73.837166 mm
    Precipitation - annual seasonality -0.20469289
    Precipitation - coldest quarter (Bio19) 247.0 mm
    Precipitation - driest month 53.27507 mm
    Precipitation - driest period (Bio14) 10.0 mm
    Precipitation - driest quarter (Bio17) 143.0 mm
    Precipitation - equinox seasonality ratio 1.3087007
    Precipitation - seasonality (Bio15) 22.0 mm
    Precipitation - spring or autumn season 0.3071198
    Precipitation - warmest quarter (Bio18) 161.0 mm
    Precipitation - wettest month 93.97284 mm
    Precipitation - wettest period (Bio13) 21.0 mm
    Precipitation - wettest quarter (Bio16) 253.0 mm
    Radiation - annual mean (Bio20) 16.1 MJ/m2/day
    Radiation - seasonality (Bio23) 42.0
    Radiation - warmest quarter (Bio26) 23.7 MJ/m2/day
    Temperature - annual max mean 18.6625 degrees C
    Temperature - annual mean (Bio01) 12.6 degrees C
    Temperature - annual min mean 5.1566668 degrees C
    Temperature - annual range 27.172516 degrees C
    Temperature - annual range (Bio07) 28.7 degrees C
    Temperature - coldest month min -0.27 degrees C
    Temperature - coldest period min (Bio06) 0.1 degrees C
    Temperature - coldest quarter mean (Bio11) 6.1 degrees C
    Temperature - diurnal range mean (Bio02) 13.4 degrees C
    Temperature - driest quarter mean (Bio09) 16.8 degrees C
    Temperature - isothermality (Bio03) 0.47 %
    Temperature - month hottest maximum 27.4 degrees C
    Temperature - seasonality (Bio04) 1.82
    Temperature - warmest month min 11.1 degrees C
    Temperature - warmest period max (Bio05) 28.8 degrees C
    Temperature - warmest quarter (Bio10) 19.4 degrees C
    Temperature - wettest quarter mean (Bio08) 6.5 degrees C
    Wind run - annual mean 142.16447 km/day
    WorldClim: Precipitation - annual 1021.0 mm
    WorldClim: Precipitation - coldest quarter 306.0 mm
    WorldClim: Precipitation - driest month 53.0 mm
    WorldClim: Precipitation - driest quarter 187.0 mm
    WorldClim: Precipitation - seasonality 21.0
    WorldClim: Precipitation - warmest quarter 198.0 mm
    WorldClim: Precipitation - wettest month 113.0 mm
    WorldClim: Precipitation - wettest quarter 318.0 mm
    WorldClim: Temperature - annual mean 116.0 degrees C * 10
    WorldClim: Temperature - annual range 274.0 degrees C * 10
    WorldClim: Temperature - coldest month min -6.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 50.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 130.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 179.0 degrees C * 10
    WorldClim: Temperature - isothermality 47.0 %
    WorldClim: Temperature - seasonality 5125.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 268.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 181.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 84.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 1.498566 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.03 km
    Euclidean Distance to Coast (metres) 84875.75 m
    Remoteness index 4.8415303
    Fire
    Fire - time since last 6.0 years
    Fire frequency 1.0 frequency
    Hydrology
    Drainage - average 1250.0 megalitres/5x5km/year
    Drainage - variability 106.0 %
    Runoff - average 189.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 0.8 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 80.40528
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 186.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 0.9 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 33.0 %
    Bulk density 1.1338748 Mg/m^3
    Carbon - organic 2.7488637 %
    Clay % 41.732483 %
    Hydrologic conductivity - average saturated 133.33333 mm/h
    Moisture Index - annual mean (Bio28) 0.7
    Moisture Index - highest quarter mean (Bio32) 1.0
    Nutrient status 2.0 index
    Ph - soil 4.0 ph
    Soil depth 1.2 m
    Soil pedality 3.6087048
    Water holding capacity 44000.0 mm
    Water stress index - month max 81.0
    Weathering Intensity V2 1.92198 Weathering Intensity Index
    Topography
    Aspect 283.0 degrees
    Averaged Topographic Relief 660.5417 metres
    Bathymetry and Topography 9 sec 604.0 m
    Elevation 633.0 m
    Topographic Slope (degrees) 14.177722 degrees
    Topographic relief 90.36969 m
    Topographic slope (%) 6.691483 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.2735 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 12.0 %
    Fractional Cover - Bare Soil (2012-03-05) 0.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 27.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 73.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0702 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.3 m^2 plant / m^2 ground
    NDVI Mean 74.0 NDVI x 100
    NPP Mean 14.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.7629 NDVI