We have just released new data filter features to improve the way you search and filter data in the ALA. There is now a default data filter in place that excludes lower quality records. You can pre-filter your search results using a suite of other data filters. To learn more, read Getting started with the data profiles.

Occurrence record: BOLD - Australian records - 3982818

GenomicDNA of ENTOMOBRYOMORPHA recorded on 2007-10-01

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3982818
Other catalog numbers recordID:1748237;ProcessID:COAUS573-10;sampleID:AUSQLDCS66
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
Collector Gemmel, N.
Supplied as "N GEMMEL"
License CC-BY-Int
Field number AUSQLDCS66
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Penelope J. M. Greenslade

Event

Field number AUSQLDCS66
Occurrence date 2007-10-01
Date precision Day

Taxonomy

Scientific name ENTOMOBRYOMORPHA
Taxon rank order
Kingdom Animalia
Phylum Arthropoda
Class Collembola
Order Entomobryomorpha
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Queensland
Locality SE MAGDALEINE
Latitude -16.628
Longitude 150.349
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Marine

Additional properties

genbank accession JN279869
markercode COI-5P
nucleotides AACTTTATATTTAATTTTTGGTGTATGGTCAGCAATAGTAGGTACCGCATTCAGTGTGTTAATCCGTTTAGAACTCGGACAACCAGGAAGTTTTATTGGGGACGACCAAATTTATAATGTTATAGTTACAGCACATGCTTTTATCATAATTTTTTTTATAGTTATGCCTATCATAATTGGGGGGTTTGGAAATTGACTAGTACCTTTAATAATCGGAGCCCCTGATATAGCCTTTCCACGAATAAATAATATAAGATTTTGACTTTTACCCCCATCTTTAATGCTTTTACTAACAGGAGGTCTAGTAGAAAGAGGAGCCGGGACAGGATGAACAGTGTATCCTCCTCTAGCATCTGGGATTGCCCATGCTGGGGCTTCAGTAGATCTATCAATCTTTAGACTTCATTTAGCAGGGGCCTCTTCTATTTTAGGTGCTGTAAACTTCATTACCACAATTATTAATATACGTAGCCCTGGAATAACTTGAGATCAAACCCCCTTATTTGTTTGATCTGTATTTCTTACTGCTATCCTTTTATTATTGTCGTTACCTGTTTTAGCCGGTGCGATCACTATACTTCTAACTGATCGTAATCTTAATACCTCTTTTTTTGACCCAGCTGGAGGGGGAGACCCTATTTTATACCAACATTTATTC
Owner institution code South Australian Museum
sequence last updated 2011-11-14T08:11:07Z

User flagged issues 

    Data quality tests

    Test name Result
    First of the month Warning
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the year Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Coral Ecoregions Coral Sea
    CAPAD 2010 Marine Coringa-Herald
    CAPAD 2012 Marine Coral Sea
    CAPAD 2014 Marine Coral Sea
    CAPAD 2016 Marine Coral Sea
    RAMSAR wetland regions Coral Sea Reserves (Coringa-Herald and Lihou Reefs and Cays)
    Area management
    National Landcare Program Management Units 2018 Marine NRM
    Biodiversity
    IMCRA 4 Regions Northeast Province
    Marine
    Australia's network of Marine Parks Coral Sea Marine Park
    FAO Fishery Statistical Areas 71
    Geomorphology of the Australian Margin and adjacent seafloor Reef
    Global Seagrass Species Richness (2003) 8.00000000
    Marine Ecoregions of the World Coral Sea
    Territorial Sea Territorial Sea

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.0
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 0.0
    Endemism 0.0074300696
    Endemism (Non-marine) 0.0
    Mammals – Fritz et al 2009 - 0.5 degree 0.0
    Occurrence Density 480.0 frequency
    Shannon Diversity (H) 4.681762 index
    Species Richness 149.0 frequency
    Distance
    Euclidean Distance to Coast (metres) 450408.53 m
    Marspec Distance to Shore 412.0 km
    Marine
    GEOMACS - geometric mean 0.001776 Pascals
    Great Barrier Reef 100m DEM -25.988327 m
    Marspec Annual Range in Sea Surface Salinity 0.39999998 100 x psu
    Marspec Annual Range in Sea Surface Temperature 4.08 100 x degrees C
    Marspec Annual Variance in Sea Surface Salinity 1.6899999 100 x psu
    Marspec Annual Variance in Sea Surface Temperature 1.8817999 10,000 x degrees C
    Marspec Bathymetric Slope 2.8 10 x degrees
    Marspec Concavity -0.002 1000 x degrees
    Marspec East/West Aspect 1.0 radians
    Marspec Maximum Monthly Sea Surface Salinity 35.329998 100 x psu
    Marspec Mean Annual Sea Surface Salinity 35.1 100 x psu
    Marspec Mean Annual Sea Surface Temperature 26.42 100 x degrees C
    Marspec Minimum Monthly Sea Surface Salinity 34.93 100 x psu
    Marspec North/South Aspect -0.01 1 x radians
    Marspec Plan Curvature -9.0E-4 x 10000
    Marspec Profile Curvature -5.9999997E-4 x 10000
    Marspec Sea Surface Temperature of the coldest ice-free month 24.4 100 x degrees C
    Marspec Sea Surface Temperature of the warmest ice-free month 28.48 100 x degrees C
    Sea Surface Temperature - MODIS Terra 26.537088 Degrees C
    SeaWIFS K490 Mean 0.044263337 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.28249565 mg/m^3
    Topography
    Averaged Topographic Relief 345.0 metres
    Bathymetry and Elvation 9 sec -208.0 m
    Topographic Slope (degrees) 0.6965907 degrees