Occurrence record:

EnvironmentalDNA of Embellisia planifunda recorded on 2012-11-08

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2012-11-08
Date precision Day

Taxonomy

Scientific name Embellisia planifunda
Taxon rank species
Kingdom Fungi
Phylum Ascomycota
Class Dothideomycetes
Order Pleosporales
Family Pleosporaceae
Genus Embellisia
Species Embellisia planifunda
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province Victoria
Locality Southern Grampians (S)
Locality Buckley Swamp
Latitude -37.84067
Longitude 142.08327
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial
Verbatim elevation 214.0

Additional properties

ammonium nitrogen mg kg 5.0
amplicon ITS1FITS4_fungi
australian soil classification Chromosols
boron hot cacl2 mg kg 0.83
broad land use Conservation and Natural Environments
color DKGR
conductivity dsm ds m 0.051
depth m 0.0
detailed land use Conservation and Natural Environments - Other minimal use - Residual native cover
dtpa copper mg kg 1.68
dtpa iron mg kg 370.68
dtpa manganese mg kg 17.41
dtpa zinc mg kg 4.94
environment Soil
exc aluminium meq 100g 0.342
exc calcium meq 100g 3.31
exc magnesium meq 100g 1.56
exc potassium meq 100g 0.22
exc sodium meq 100g 0.28
general ecological zone Temperate
gravel 0.0
nitrate nitrogen mg kg 1.0
otu CACAATATGAAGGCGGGCTGGCACTCCTTGAGAGGACCGGCCTTGCTGAATTATTCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGTTCGCCCACCACCAGGACAAACCATAAACCTTTTGCAATTGCAATCAGCGTCAGTAACAACATAATAATTA
otucount 2
organic carbon 4.27
ph level cacl2 cacl2 4.6
ph level h2o h2o 5.6
phosphorus colwell mg kg 4.0
potassium colwell mg kg 84.0
sample id 102.100.100/8288
sample type Soil
slope 15.0
soil moisture 7.8
sulphur mg kg 5.5
texture 2.5
vegetation type Grassland
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Altitude out of range Passed
    Altitude value non-numeric Passed
    Altitude value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 12 missing properties
    Show/Hide 45 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) Fallow less than 3 months
    Fallow practice - dominant (number) Fallow less than 3 months
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Irrigation practice - dominant No irrigation
    Land use Modified pastures
    NRM Regions 2010 Glenelg Hopkins
    NRM Regions 2014 Glenelg Hopkins
    NRM Regions 2015 Glenelg Hopkins
    NRM Regions 2017 Glenelg Hopkins
    NRM Regions 2017 (Qld 2019) Glenelg Hopkins
    Stubble practice - dominant (area) Removed by hot burn
    Stubble practice - dominant (number) Removed by hot burn
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 Glenelg Hopkins
    Biodiversity
    Freshwater Ecoregions of the World Bass Strait Drainages
    IBRA 6 Regions Victorian Volcanic Plain
    IBRA 6 Sub Regions Victorian Volcanic Plain
    IBRA 7 Regions Southern Volcanic Plain
    IBRA 7 Subregions Victorian Volcanic Plain
    Terrestrial Ecoregional Boundaries Southeast Australia Temperate Forests
    World Anthropogenic Biomes (2000) Remote croplands
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Koppen Climate Classification (All Classes) Temperate: no dry season (warm summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Pasture, cropland (temperate)
    Hydrology
    Drainage Divisions Level 1 South East Coast (Victoria)
    Drainage Divisions Level 2 GLENELG RIVER
    River Regions GLENELG RIVER
    Marine
    Marine Ecoregions of the World Western Bassian
    States including coastal waters Victoria (including Coastal Waters)
    Political
    ASGS Australian States and Territories Victoria
    Australian States and Territories Victoria
    Commonwealth Electoral Boundaries Wannon
    Local Government Areas 2011 Southern Grampians (S)
    Local Government Areas 2012 deprecated S. Grampians Bal
    Local Government Areas PSMA 2018 SOUTHERN GRAMPIANS SHIRE
    National Native Title Register (NNTR, Determinations of Native Title) - boundaries and core attributes Gunditjmara & Eastern Maar
    Native Title Determinations (13/7/2020) Gunditjmara & Eastern Maar VCD2011/001
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 26
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 721
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF VIC.
    PSMA ABS SA2 Statistical Areas (2016) SOUTHERN GRAMPIANS
    PSMA ABS SA3 Statistical Areas (2016) GLENELG - SOUTHERN GRAMPIANS
    PSMA ABS SA4 Statistical Areas (2016) WARRNAMBOOL AND SOUTH WEST
    PSMA Commonwealth Electoral Boundaries (2016) WANNON
    PSMA Commonwealth Electoral Boundaries (2018) WANNON
    PSMA Indigenous Areas (2016) SOUTHERN GRAMPIANS - GLENELG
    PSMA Indigenous Locations (2016) SOUTHERN GRAMPIANS
    PSMA Indigenous Regions (2016) VICTORIA EXC. MELBOURNE
    PSMA Localities (2018) BUCKLEY SWAMP
    PSMA Remoteness Areas (2016) Outer Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (VIC.)
    PSMA State Electoral Boundaries (2016) LOWAN
    PSMA State Electoral Boundaries (2018) LOWAN
    PSMA States (2016) VICTORIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (VIC.)
    PSMA Wards (2018) SOUTHERN GRAMPIANS SHIRE
    Statistical Local Areas S. Grampians (S) Bal
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Otway Region
    Surface Geology of Australia Qbn
    Topography
    Physiographic Provinces of Australia Kosciuszkan Uplands Province
    Physiographic Regions 2011 West Victorian Plains
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Annual crops and highly modified pastures
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Replaced
    Vegetation types - native Eucalypt woodlands
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 1.3425117E7 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.6274
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.0543
    Endemism 0.0081646005
    Endemism (Non-marine) 0.009154446
    Mammals – Fritz et al 2009 - 0.5 degree 0.3689
    Migratory species (2008) 4.0 frequency
    Occurrence Density 12705.0 frequency
    Shannon Diversity (H) 4.701494 index
    Species Richness 982.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 9.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.7035689
    2030A1BMk35M: Evaporation - month min 37.09 mm
    2030A1BMk35M: Precipitation - annual mean 50.305832 mm
    2030A1BMk35M: Precipitation - driest month 22.89 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.326891
    2030A1BMk35M: Precipitation - spring or autumn season 0.32442236
    2030A1BMk35M: Temperature - annual max mean 19.626667 degrees C
    2030A1BMk35M: Temperature - annual min mean 8.631667 degrees C
    2030A1BMk35M: Temperature - annual range 21.529999 degrees C
    Aridity index - annual mean 0.9121744
    Aridity index - month max 2.1165645
    Aridity index - month min 0.1652163
    Evaporation - annual mean 107.239914 (ml/5km x 5km pixel)
    Evaporation - average 14022.0 ml
    Evaporation - month max 211.8435 mm
    Evaporation - month min 32.6 mm
    Evaporation - variability 6.0 %
    Growth index C3 macrotherm plants - annual mean 0.03 index
    Growth index C3 mesotherm plants - annual mean 0.28 index
    Growth index C4 megatherm plants - annual mean 0.02 index
    Humidity - annual mean relative 85.820724 %
    Humidity - annual mean relative 3pm 72.63315 %
    Humidity - month max relative 97.657524 %
    Humidity - month max relative 3pm 85.762054 %
    Humidity - month min relative 59.384575 %
    Humidity - month min relative 3pm 59.384575 %
    Precipitation - annual 704.0 mm
    Precipitation - annual (Bio12) 678.0 mm
    Precipitation - annual mean 60.47612 mm
    Precipitation - annual seasonality -0.54445267
    Precipitation - coldest quarter (Bio19) 234.0 mm
    Precipitation - driest month 34.0 mm
    Precipitation - driest period (Bio14) 6.0 mm
    Precipitation - driest quarter (Bio17) 101.0 mm
    Precipitation - equinox seasonality ratio 1.1837112
    Precipitation - seasonality (Bio15) 32.0 mm
    Precipitation - spring or autumn season 0.18263245
    Precipitation - warmest quarter (Bio18) 102.0 mm
    Precipitation - wettest month 88.0 mm
    Precipitation - wettest period (Bio13) 20.0 mm
    Precipitation - wettest quarter (Bio16) 235.0 mm
    Radiation - annual mean (Bio20) 15.4 MJ/m2/day
    Radiation - seasonality (Bio23) 45.0
    Radiation - warmest quarter (Bio26) 23.2 MJ/m2/day
    Temperature - annual max mean 17.909166 degrees C
    Temperature - annual mean (Bio01) 13.2 degrees C
    Temperature - annual min mean 7.306667 degrees C
    Temperature - annual range 20.299988 degrees C
    Temperature - annual range (Bio07) 21.8 degrees C
    Temperature - coldest month min 4.14 degrees C
    Temperature - coldest period min (Bio06) 4.4 degrees C
    Temperature - coldest quarter mean (Bio11) 9.0 degrees C
    Temperature - diurnal range mean (Bio02) 10.8 degrees C
    Temperature - driest quarter mean (Bio09) 17.8 degrees C
    Temperature - isothermality (Bio03) 0.5 %
    Temperature - month hottest maximum 24.85 degrees C
    Temperature - seasonality (Bio04) 1.22
    Temperature - warmest month min 10.93 degrees C
    Temperature - warmest period max (Bio05) 26.2 degrees C
    Temperature - warmest quarter (Bio10) 17.9 degrees C
    Temperature - wettest quarter mean (Bio08) 9.0 degrees C
    Wind run - annual mean 215.80113 km/day
    WorldClim: Precipitation - annual 721.0 mm
    WorldClim: Precipitation - coldest quarter 249.0 mm
    WorldClim: Precipitation - driest month 27.0 mm
    WorldClim: Precipitation - driest quarter 100.0 mm
    WorldClim: Precipitation - seasonality 32.0
    WorldClim: Precipitation - warmest quarter 100.0 mm
    WorldClim: Precipitation - wettest month 94.0 mm
    WorldClim: Precipitation - wettest quarter 254.0 mm
    WorldClim: Temperature - annual mean 130.0 degrees C * 10
    WorldClim: Temperature - annual range 208.0 degrees C * 10
    WorldClim: Temperature - coldest month min 43.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 86.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 107.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 175.0 degrees C * 10
    WorldClim: Temperature - isothermality 51.0 %
    WorldClim: Temperature - seasonality 3411.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 251.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 175.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 92.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.041231055 degrees
    Distance - to coast 0.4588028 km x 100
    Distance - to non-permanent water (weighted) 0.26999998 degrees
    Distance - to permanent water (weighted) 0.041231055 km
    Euclidean Distance to Coast (metres) 82036.21 m
    Remoteness index 2.7803204
    Hydrology
    Drainage - average 2213.0 megalitres/5x5km/year
    Drainage - variability 58.0 %
    Runoff - average 145.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 1.1 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 81.0
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 79.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.47 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 32.0 %
    Bulk density 1.5802976 Mg/m^3
    Carbon - organic 1.6336917 %
    Clay % 40.809525 %
    Hydrologic conductivity - average saturated 17.5 mm/h
    Moisture Index - annual mean (Bio28) 0.65
    Moisture Index - highest quarter mean (Bio32) 1.0
    Nutrient status 1.75 index
    Ph - soil 3.0 ph
    Soil depth 0.8 m
    Soil pedality 3.1380951
    Water holding capacity 42000.0 mm
    Water stress index - month max 81.0
    Weathering Intensity V2 5.63886 Weathering Intensity Index
    Topography
    Aspect 42.0 degrees
    Averaged Topographic Relief 85.708336 metres
    Bathymetry and Topography 9 sec 201.0 m
    Elevation 195.0 m
    Topographic Slope (degrees) 0.35978734 degrees
    Topographic relief 5.78363 m
    Topographic slope (%) 0.3154921 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.205 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 23.0 %
    Fractional Cover - Bare Soil (2012-03-05) 8.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 64.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 28.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0115 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.3 m^2 plant / m^2 ground
    NDVI Mean 69.0 NDVI x 100
    NPP Mean 4.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.3631 NDVI