Occurrence record: BOLD - Australian records - 3543647

GenomicDNA of LEPIDOPTERA | Moths recorded on 2007-08-15

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3543647
Other catalog numbers recordID:1443798;ProcessID:LEFIH312-10;sampleID:MM15246
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Edwards, E.D.|Horak, M.
Supplied as "E. D. Edwards, M. Horak"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Field number MM15246
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Mari Kekkonen

Event

Field number MM15246
Record date 2007-08-15
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type wellformed

Geospatial

Country Australia
State / Province Northern Territory
Locality East Arnhem (S)
Locality Manangaymi, Nhulunbuy
Latitude -12.2
Longitude 136.4
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HM876929
markercode COI-5P
nucleotides AACATTATACTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCTCTAAGACTTCTTATTCGAGCTGAATTAGGTAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATGTTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCTCCCTCTCTTACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTATACCCCCCACTTTCATCTAATATCGCTCACGGAGGAAGATCTGTAGACTTAGCTATTTTTTCATTACATTTAGCGGGAATTTCATCAATTTTAGGAGCAATTAACTTTATTACTACAATTATTAATATACGATTAAATAATATATCTTTTGATCAAATACCATTATTTGTTTGAGCAGTAGGAATTACAGCATTATTATTATTACTTTCATTACCTGTATTAGCTGGAGCTATTACAATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT
Owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:30Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Tropical Savanna Australian Tropical Savanna
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Global 200 priority ecoregions - Terrestrial Northern Australia and Trans-Fly Savannas
    Irrigation practice - dominant No irrigation
    Land use Managed resource protected areas
    NRM Regions 2010 Northern Territory
    NRM Regions 2014 Northern Territory
    NRM Regions 2015 Northern Territory
    NRM Regions 2017 Northern Territory
    NRM Regions 2017 (Qld 2019) Northern Territory
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Northern Territory
    Biodiversity
    Freshwater Ecoregions of the World Arafura - Carpentaria
    IBRA 6 Regions Arnhem Coast
    IBRA 6 Sub Regions Arnhem Coast P3
    IBRA 7 Regions Arnhem Coast
    IBRA 7 Subregions Nhulunbuy
    Terrestrial Ecoregional Boundaries Arnhem Land Tropical Savanna
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Strongly developed wet and dry seasons with plant growth determined by moisture availability
    Koppen Climate Classification (All Classes) Tropical: savanna
    Koppen Climate Classification (Major Classes) Tropical
    Fire
    Fire regime niches Eucalypt savanna woodland (monsoon tropical)
    Hydrology
    Drainage Divisions Level 1 Tanami-Timor Sea Coast
    Drainage Divisions Level 2 BUCKINGHAM RIVER
    River Regions BUCKINGHAM RIVER
    Marine
    Estuary habitat mapping 13304 Arnhem Bay Mangrove
    Marine Ecoregions of the World Arnhem Coast to Gulf of Carpenteria
    States including coastal waters Northern Territory (including Coastal Waters)
    Political
    ASGS Australian States and Territories Northern Territory
    Australian States and Territories Northern Territory
    Commonwealth Electoral Boundaries Lingiari
    Local Government Areas 2011 East Arnhem (S)
    Local Government Areas 2012 deprecated East Arnhem - Bal
    Local Government Areas PSMA 2018 EAST ARNHEM REGION
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 369
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 450
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF NT
    PSMA ABS SA2 Statistical Areas (2016) EAST ARNHEM
    PSMA ABS SA3 Statistical Areas (2016) EAST ARNHEM
    PSMA ABS SA4 Statistical Areas (2016) NORTHERN TERRITORY - OUTBACK
    PSMA Commonwealth Electoral Boundaries (2016) LINGIARI
    PSMA Commonwealth Electoral Boundaries (2018) LINGIARI
    PSMA Indigenous Areas (2016) LAYNHAPUY - GUMATJ HOMELANDS
    PSMA Indigenous Locations (2016) GUMATJ - SURROUNDS
    PSMA Indigenous Regions (2016) NHULUNBUY
    PSMA Localities (2018) EAST ARNHEM
    PSMA Remoteness Areas (2016) Very Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (NT)
    PSMA State Electoral Boundaries (2016) NHULUNBUY
    PSMA State Electoral Boundaries (2018) NHULUNBUY
    PSMA States (2016) NORTHERN TERRITORY
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (NT)
    PSMA Wards (2018) GUMURR MIWATJ WARD
    Statistical Local Areas East Arnhem (S)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia McArthur Region
    Surface Geology of Australia Qe
    Topography
    Physiographic Provinces of Australia North Australian Plateaus Province
    Physiographic Regions 2011 Top End Coastal Plains
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Indigenous owned, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    NVIS 4.1 Major Vegetation Groups Mangroves
    NVIS 4.1 Major Vegetation Subgroups Mangroves
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Residual
    Vegetation types - native Mangroves,tidal mudflats,samphires and bare areas,claypan,sand,rock,salt lakes,lagoons,lakes
    Vegetation types - present Mangroves

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 1.0309905E7 $
    Natural resource management expenditure - additional 0.0 $/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.4673
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 1.9514
    Endemism 0.013353956
    Endemism (Non-marine) 0.014634695
    Mammals – Fritz et al 2009 - 0.5 degree 0.2691
    Migratory species (2008) 4.0 frequency
    Occurrence Density 222.0 frequency
    Shannon Diversity (H) 2.7131999 index
    Species Richness 53.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 5.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.6388417
    2030A1BMk35M: Aridity index - month max 1.8584113
    2030A1BMk35M: Aridity index - month min 0.012777804
    2030A1BMk35M: Evaporation - annual mean 182.55042 mm
    2030A1BMk35M: Evaporation - month max 223.24 mm
    2030A1BMk35M: Evaporation - month min 148.67 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.45 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.11 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.43 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 74.59273 %
    2030A1BMk35M: Humidity - month max relative 3pm 83.31899 %
    2030A1BMk35M: Humidity - month min relative 3pm 69.18912 %
    2030A1BMk35M: Precipitation - annual mean 108.29083 mm
    2030A1BMk35M: Precipitation - driest month 2.57 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.0727917
    2030A1BMk35M: Precipitation - max difference between successive months 4.4059033 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -5.056871 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 30.938448
    2030A1BMk35M: Precipitation - spring or autumn season -12.400582
    2030A1BMk35M: Precipitation - summer or winter season 28.727346
    2030A1BMk35M: Precipitation - wettest month 289.15 mm
    2030A1BMk35M: Precipitation deficit - annual mean -74.25958 mm
    2030A1BMk35M: Precipitation deficit - month max -219.85 mm
    2030A1BMk35M: Precipitation deficit - month min 127.62001 mm
    2030A1BMk35M: Radiation - max month precipitation modified 27.25 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 20.695833 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 16.07 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 32.0125 degrees C
    2030A1BMk35M: Temperature - annual min mean 23.965834 degrees C
    2030A1BMk35M: Temperature - annual range 13.279999 degrees C
    2030A1BMk35M: Temperature - coldest month min 20.42 degrees C
    2030A1BMk35M: Temperature - coolest month max 29.69 degrees C
    2030A1BMk35M: Temperature - max difference in max 1.269989 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 2.1099854 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 9.98999 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 8.046669 degrees C
    2030A1BMk35M: Temperature - min difference in max -1.3099976 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -1.6600037 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 6.210022 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 33.7 degrees C
    2030A1BMk35M: Temperature - warmest month min 26.67 degrees C
    Aridity index - annual mean 0.6112656
    Aridity index - month max 1.6848173
    Aridity index - month min 0.008931927
    Evaporation - annual mean 192.89331 (ml/5km x 5km pixel)
    Evaporation - average 24469.0 ml
    Evaporation - month max 241.75192 mm
    Evaporation - month min 156.1 mm
    Evaporation - variability 16.0 %
    Growth index C3 macrotherm plants - annual mean 0.46 index
    Growth index C3 mesotherm plants - annual mean 0.2 index
    Growth index C4 megatherm plants - annual mean 0.42 index
    Humidity - annual mean relative 83.07444 %
    Humidity - annual mean relative 3pm 73.8627 %
    Humidity - month max relative 89.008804 %
    Humidity - month max relative 3pm 82.086945 %
    Humidity - month min relative 68.59914 %
    Humidity - month min relative 3pm 68.59914 %
    Precipitation - annual 1297.0 mm
    Precipitation - annual (Bio12) 1378.0 mm
    Precipitation - annual (log) seasonality index 0.21588902
    Precipitation - annual mean 108.333336 mm
    Precipitation - annual seasonality 2.4135594
    Precipitation - annual seasonality ratio 3.4217687
    Precipitation - autumn 521.0 mm
    Precipitation - autumn reliability 28.0 %
    Precipitation - coldest quarter (Bio19) 22.0 mm
    Precipitation - driest month 2.0 mm
    Precipitation - driest period (Bio14) 0.0 mm
    Precipitation - driest quarter (Bio17) 11.0 mm
    Precipitation - equinox seasonality ratio 0.09751434
    Precipitation - max difference between successive months 4.3462367 mm/day
    Precipitation - min difference between successive months -4.7311826 mm/day
    Precipitation - seasonality (Bio15) 105.0 mm
    Precipitation - solstice seasonality ratio 21.6875
    Precipitation - spring 51.0 mm
    Precipitation - spring or autumn (log) season -0.5846888
    Precipitation - spring or autumn season -9.076923
    Precipitation - spring reliability 16.0 %
    Precipitation - summer 693.0 mm
    Precipitation - summer or winter (log) season 0.87155664
    Precipitation - summer or winter season 20.060606
    Precipitation - summer reliability 68.0 %
    Precipitation - warmest quarter (Bio18) 541.0 mm
    Precipitation - wettest month 265.0 mm
    Precipitation - wettest period (Bio13) 73.0 mm
    Precipitation - wettest quarter (Bio16) 854.0 mm
    Precipitation - winter 32.0 mm
    Precipitation - winter reliability 19.0 %
    Precipitation deficit - annual mean -84.74269 mm
    Precipitation deficit - month max -230.74808 mm
    Precipitation deficit - month min 106.899994 mm
    Radiation - annual mean (Bio20) 20.6 MJ/m2/day
    Radiation - coldest quarter (Bio27) 18.5 MJ/m2/day
    Radiation - driest quarter (Bio25) 22.7 MJ/m2/day
    Radiation - highest period (Bio21) 27.7 MJ/m2/day
    Radiation - lowest period (Bio22) 15.9 MJ/m2/day
    Radiation - max month precipitation modified 27.08416 MJ/m2/day
    Radiation - mean annual precipitation modified 20.62368 MJ/m2/day
    Radiation - min month precipitation modified 15.9 MJ/m2/day
    Radiation - seasonality (Bio23) 17.0
    Radiation - warmest quarter (Bio26) 22.9 MJ/m2/day
    Radiation - wettest quarter (Bio24) 19.5 MJ/m2/day
    Temperature - annual max mean 30.604166 degrees C
    Temperature - annual mean (Bio01) 27.2 degrees C
    Temperature - annual min mean 22.514166 degrees C
    Temperature - annual range 14.5 degrees C
    Temperature - annual range (Bio07) 13.5 degrees C
    Temperature - coldest month min 19.33 degrees C
    Temperature - coldest period min (Bio06) 19.5 degrees C
    Temperature - coldest quarter mean (Bio11) 24.9 degrees C
    Temperature - coolest month max 28.13 degrees C
    Temperature - diurnal range mean (Bio02) 8.0 degrees C
    Temperature - driest quarter mean (Bio09) 25.7 degrees C
    Temperature - isothermality (Bio03) 0.59 %
    Temperature - max absolute mean max 37.0 degrees C
    Temperature - max difference in max 1.2799988 degrees C/day
    Temperature - max difference in min 2.269989 degrees C/day
    Temperature - max month diurnal range 9.880005 degrees C
    Temperature - mean annual absolute mean min 15.667528 degrees C
    Temperature - mean annual diurnal range 8.089996 degrees C
    Temperature - min absolute mean min 10.560928 degrees C
    Temperature - min difference in max -1.3099976 degrees C/day
    Temperature - min difference in min -1.8500061 degrees C/day
    Temperature - min month diurnal range 6.48999 degrees C
    Temperature - month hottest maximum 32.45 degrees C
    Temperature - month mean absolute max 35.26001 degrees C
    Temperature - seasonality (Bio04) 0.55
    Temperature - warmest month min 25.06 degrees C
    Temperature - warmest period max (Bio05) 33.0 degrees C
    Temperature - warmest quarter (Bio10) 29.1 degrees C
    Temperature - wettest quarter mean (Bio08) 28.5 degrees C
    Vapour pressure deficit - annual mean 0.53495085 KPa
    Vapour pressure deficit - annual mean 9am 0.60630256 KPa
    Vapour pressure deficit - month max 0.69936085 KPa
    Vapour pressure deficit - month max 9am 0.69936085 KPa
    Vapour pressure deficit - month min 0.35644937 KPa
    Vapour pressure deficit - month min 9am 0.44322228 KPa
    Wind run - annual mean 165.31679 km/day
    Wind run - month max 205.29266 km/day
    Wind run - month min 128.83902 km/day
    Wind speed - annual mean 3pm 3.8219512 m/s
    Wind speed - annual mean 9am 2.6997962 m/s
    Wind speed - annual mean 9am or 3pm 4.1182923 m/s
    Wind speed - month max 3pm 4.7 m/s
    Wind speed - month max 9am 3.5365846 m/s
    Wind speed - month max 9am or 3pm 4.7 m/s
    Wind speed - month min 3pm 2.9 m/s
    Wind speed - month min 9am 1.8682923 m/s
    Wind speed - month min 9am or 3pm 1.8682923 m/s
    WorldClim: Precipitation - annual 1409.0 mm
    WorldClim: Precipitation - coldest quarter 29.0 mm
    WorldClim: Precipitation - driest month 3.0 mm
    WorldClim: Precipitation - driest quarter 14.0 mm
    WorldClim: Precipitation - seasonality 101.0
    WorldClim: Precipitation - warmest quarter 530.0 mm
    WorldClim: Precipitation - wettest month 297.0 mm
    WorldClim: Precipitation - wettest quarter 850.0 mm
    WorldClim: Temperature - annual mean 270.0 degrees C * 10
    WorldClim: Temperature - annual range 140.0 degrees C * 10
    WorldClim: Temperature - coldest month min 194.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 246.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 85.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 249.0 degrees C * 10
    WorldClim: Temperature - isothermality 60.0 %
    WorldClim: Temperature - seasonality 1616.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 334.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 288.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 281.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.05830952 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.03 km
    Euclidean Distance to Coast (metres) 7158.681 m
    Remoteness index 14.534253
    Fire
    Fire - time since last 2.0 years
    Fire frequency 4.0 frequency
    Hydrology
    Drainage - average 610.0 megalitres/5x5km/year
    Drainage - variability 110.0 %
    Runoff - average 7807.0 megalitres/5x5km/year
    Water Observations From Space 92.73743 Percentage
    Social
    Age 24.5 years
    Age - prime group 31.4 Count
    Disadvantaged 560.994 points (mean=1000)
    Education - degrees 3.5 %
    Education - vocational training 7.9 %
    Employment 1.6 %
    Home ownership 4.5 %
    Income - high 34.4 %
    Income - low 6.2 %
    Internet 19.4 %
    Population - change 12.4 count
    Population - density SLA 2006 p/sqkm) 0.2 people/km^2
    Unemployment rate 9.4 %
    Work force - older 15.3 Count
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.48796615
    2030A1BMk35M: Crop factor - month max 0.90000004
    2030A1BMk35M: Crop factor - month min 0.012777804
    2030A1BMk35M: Water deficit - month max 74.16057 mm
    2030A1BMk35M: Water deficit - month mean 16.5067 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -0.9287994 MPa
    2030A1BMk35M: Water potential - month max -2.8643754E-14 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 43.91695
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 1.1500025
    2030A1BMk35M: Water surplus - annual mean 23.976084 mm
    2030A1BMk35M: Water surplus - month max 130.04901 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 109.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.01 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 13.0 %
    Bouguer gravity anomalies 295.8445 Gal
    Bulk density 0.94526315 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic 0.6060081 %
    Carbon store pre-European 56.04555 kgC/ha
    Clay % 30.421053 %
    Crop factor - annual mean 0.49725747
    Crop factor - month max 0.9
    Crop factor - month min 0.008931927
    Erodibility 68.0 k factor
    Erosional surfaces - proportion 0.0 %
    Erosivity 10577.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 12.029412 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 2.588 my
    Lithology - fertility 6.0 index
    Lithology - mean age 1.294 my
    Lithology - mean age (log) 0.11193429 log my
    Lithology - mean age range (log) 0.41296428 log my
    Magnetic anomalies 66.0 nT
    Moisture - average 43.0 %
    Moisture - variability 11.0 %
    Moisture Index - annual mean (Bio28) 0.51
    Moisture Index - coldest quarter mean (Bio35) 0.08
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 1.0
    Moisture Index - lowest period (Bio30) 0.01
    Moisture Index - lowest quarter mean (Bio33) 0.02
    Moisture Index - seasonality (Bio31) 86.0
    Moisture Index - warmest quarter mean (Bio34) 0.62
    Nitrogen - plant-available pre-European 4973.116 kgN/ha
    Nitrogen concentration pre-European 27.06742 mgN kg/H2O
    Nitrogen store pre-European 79.34451 kgN/ha
    Nutrient status 1.0 index
    Pedality hydrological score 2.7263157
    Phosphorus - plant-available pre-European 14.45238 kgP/ha
    Phosphorus - plant-available total pre-European 837.7244 kgP/ha
    Phosphorus pre-European 4.930253 mgP kg/H2O
    Soil depth 1.1 m
    Soil pedality 2.7263157
    Soils - coarse 0.0 class
    Substrate data reliability 3.0
    Topographic wetness index 11.66046
    Unreliable water retention parameters 0.0
    Water deficit - month max 96.6947 mm
    Water deficit - month mean 21.620665 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 23000.0 mm
    Water holding capacity - plant-available 142.0 mm
    Water potential - annual mean -0.92886055 MPa
    Water potential - month max -2.8643754E-14 MPa
    Water potential - month min -1.5 MPa
    Water stress index - annual mean 44.75317
    Water stress index - month max 81.0
    Water stress index - month min 0.8038734
    Water surplus - annual mean 18.648336 mm
    Water surplus - month max 122.51001 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 3.38568 Weathering Intensity Index
    Topography
    Aspect 229.0 degrees
    Averaged Topographic Relief 25.875 metres
    Bathymetry and Topography 9 sec 2.0 m
    Elevation 2.0 m
    Ridge top flatness 6.911138
    Ridge top flatness - proportion 68.75 %
    Slope length 1000.0 m
    Topographic Slope (degrees) 0.0 degrees
    Topographic relief 1.461148 m
    Topographic roughness 15.30369 %
    Topographic slope (%) 0.06251326 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 3.987333
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3517 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 49.0 %
    Gross Primary Productivity (2012-03-13) 0.0048 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 1.4 m^2 plant / m^2 ground
    NDVI Mean 57.0 NDVI x 100
    NPP Mean 5.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.5341 NDVI