Occurrence record: BOLD - Australian records - 3570408

GenomicDNA of ARTHROPODA | Arthropods recorded on 2000-08-04

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3570408
Other catalogue numbers recordID:1445710;ProcessID:LIMC715-10;sampleID:HLC-27468
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
Collector/Observer Dewaard, J.
Supplied as "J. deWaard"
License CC-BY-Int
Field number L#LIZIS-114
Occurrence status present
Abcd identification qualifier Not provided

Event

Field number L#LIZIS-114
Record date 2000-08-04
Date precision Day

Taxonomy

Scientific name ARTHROPODA
Taxon rank phylum
Common name Arthropods
Kingdom Animalia
Phylum Arthropoda
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Queensland

Additional properties

markercode COI-5P
nucleotides --CCTTATATTTTATTTTTGGAGCCTGAGCAGGTATAATTGGGACTTCTTTAAGACTTATTATTCGTGCTGAATTAGGTCAACCAGGTACTTTAATTGGAAATGACCAAATTTATAATGTAGTAGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGGGGATTTGGTAATTGGTTAGTACCGTTAATACTAGGTGCACCAGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGGTTACTTCCTCCTTCACTAACTTTATTACTTATAAGAGGTATAGTAGAAAGAGGTGTTGGTACCGGATGAACAGTATATCCTCCACTTGCAGGTGCTATCGCTCATTCAGGTGCCTCTGTTGATATAGGAATTTTTTCCTTACACTTAGCAGGAGTTTCCTCAATTCTAGGAGCAATTAATTTTATAACCACAGTTATTAATATACGCTCATTTGGTATAAATTTAGATCAAATACCTTTATTTGTATGAGCAGTATTTATTACTGCAATTTTACTTCTTTTATCTCTTCCAGTTCTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACCTCATTTTTTGACCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTC
owner institution code Biodiversity Institute of Ontario
sequence last updated 2011-11-14T08:11:45Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Coordinates dont match supplied state Passed
    Show/Hide 14 missing properties
    Show/Hide 56 tests that have not been run