We have just released new data filter features to improve the way you search and filter data in the ALA. There is now a default data filter in place that excludes lower quality records. You can pre-filter your search results using a suite of other data filters. To learn more, read Getting started with the data profiles.

Occurrence record: BOLD - Australian records - 2920100

GenomicDNA of Argyrops spinifer | Frypan Bream recorded on 1994-11-04

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 2920100
Other catalog numbers recordID:30016;ProcessID:FOA677-04;sampleID:BW-A677
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
License CC-BY-Int
Occurrence remarks
Occurrence status present
Abcd identification qualifier Not provided

Event

Occurrence date 1994-11-04
Date precision Day

Taxonomy

Scientific name Argyrops spinifer
Taxon rank species
Common name Frypan Bream
Kingdom Animalia
Phylum Chordata
Class Actinopterygii
Order Perciformes
Family Sparidae
Genus Argyrops
Species Argyrops spinifer
Taxonomic issue No issues
Name match metric Canonical name match
The supplied name was parsed into canonical form before a match was found.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Western Australia
Latitude -19.6667
Longitude 116.917
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Marine

Additional properties

genbank accession DQ107838
markercode COI-5P
nucleotides CCTTTATCTTGTATTTGGTGCTTGGGCCGGAATAGTCGGGACTGCCTTAAGCCTGCTCATTCGAGCTGAGCTTAGCCAGCCCGGGGCTCTTCTAGGCGACGACCAGATTTATAATGTAATTGTTACAGCACACGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGAAACTGATTAATTCCACTAATAATCGGTGCCCCTGATATGGCATTCCCTCGAATAAACAACATAAGCTTCTGACTACTCCCTCCCTCATTCCTCCTCCTACTCGCCTCCTCAGGAGTTGAGGCTGGAGCTGGCACTGGATGAACAGTCTACCCCCCACTAGCGGGCAATCTCGCTCACGCAGGAGCATCAGTCGATCTAACCATCTTCTCCCTTCACTTAGCGGGCATTTCATCAATTCTTGGTGCAATTAATTTTATCACAACCATCATTAATATAAAACCCCCTGCTATTACTCAGTATCAAACCCCTCTATTTGTTTGAGCTGTTCTCATTACCGCCGTCCTCCTTCTTTTATCCCTCCCAGTCCTTGCTGCAGGAATTACAATGCTACTTACCGACCGCAACCTAAACACCACCTTCTTTGACCCTGCCGGAGGAGGGGACCCTATTCTCTACCAACACTTATTC
Owner institution code Biodiversity Institute of Ontario
sequence last updated 2011-11-14T08:11:24Z

User flagged issues 

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Habitat incorrect for species Passed
    Show/Hide 13 missing properties
    Show/Hide 48 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Coral Ecoregions Ningaloo Reef & NW Western Australia
    Australian Tropical Savanna Australian Tropical Savanna
    Global 200 priority ecoregions - Marine Western Australia Marine
    Area management
    National Landcare Program Management Units 2018 Marine NRM
    Biodiversity
    IMCRA 4 Regions Northwest Shelf Province
    IMCRA Meso-scale Bioregions Northwest Shelf
    Marine
    Continental Shelf Continental Shelf
    Exclusive Economic Zone Exclusive Economic Zone
    FAO Fishery Statistical Areas 57
    Geomorphology of the Australian Margin and adjacent seafloor Shelf
    Global Seagrass Species Richness (2003) 11.00000000
    Marine Ecoregions of the World Exmouth to Broome
    IGBP Land Cover vegetation classification scheme (2011) Water

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.0
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 0.0
    Endemism 0.001999894
    Endemism (Non-marine) 0.0
    Mammals – Fritz et al 2009 - 0.5 degree 0.0
    Occurrence Density 48.0 frequency
    Shannon Diversity (H) 3.1813111 index
    Species Richness 31.0 frequency
    Distance
    Euclidean Distance to Coast (metres) 101966.19 m
    Marspec Distance to Shore 77.0 km
    Marine
    GEOMACS - geometric mean 0.053447 Pascals
    Marspec Annual Range in Sea Surface Salinity 0.42999998 100 x psu
    Marspec Annual Range in Sea Surface Temperature 5.17 100 x degrees C
    Marspec Annual Variance in Sea Surface Salinity 1.5899999 100 x psu
    Marspec Annual Variance in Sea Surface Temperature 3.6337998 10,000 x degrees C
    Marspec Bathymetric Slope 0.1 10 x degrees
    Marspec Concavity -0.001 1000 x degrees
    Marspec East/West Aspect -0.77 radians
    Marspec Maximum Monthly Sea Surface Salinity 35.26 100 x psu
    Marspec Mean Annual Sea Surface Salinity 35.01 100 x psu
    Marspec Mean Annual Sea Surface Temperature 26.64 100 x degrees C
    Marspec Minimum Monthly Sea Surface Salinity 34.829998 100 x psu
    Marspec North/South Aspect 0.63 1 x radians
    Marspec Plan Curvature 0.0 x 10000
    Marspec Profile Curvature 1.0E-4 x 10000
    Marspec Sea Surface Temperature of the coldest ice-free month 23.91 100 x degrees C
    Marspec Sea Surface Temperature of the warmest ice-free month 29.08 100 x degrees C
    Sea Surface Temperature - MODIS Terra 26.917198 Degrees C
    SeaWIFS K490 Mean 0.05086034 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.27744663 mg/m^3
    Topography
    Averaged Topographic Relief 9.875 metres
    Bathymetry and Elvation 9 sec -78.0 m
    Topographic Slope (degrees) 0.11797701 degrees