Occurrence record:

EnvironmentalDNA of Monoblepharidomycetes recorded on 2014-12-10

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated sequences https://www.ncbi.nlm.nih.gov/biosample/SAMN07488630
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2014-12-10
Date precision Day

Taxonomy

Scientific name Monoblepharidomycetes
Taxon rank class
Kingdom Fungi
Phylum Chytridiomycota
Class Monoblepharidomycetes
Order unclassified Monoblepharidomycetes
Family unclassified Monoblepharidomycetes
Genus unclassified Monoblepharidomycetes
Species Monoblepharidomycetes sp
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province South Australia
Locality Yankalilla (DC)
Locality Fisheries Beach
Latitude -35.632738
Longitude 138.1164129
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial
Verbatim elevation 20.0

Additional properties

ammonium nitrogen mg kg 2.0
amplicon ITS1FITS4_fungi
australian soil classification Sodosols
boron hot cacl2 mg kg 0.9
broad land use Conservation and Natural Environments
clay 17.43
color BR
conductivity dsm ds m 0.174
course sand 16.02
depth m 0.0
detailed land use Conservation and Natural Environments - Nature conservation - Other conserved area
dtpa copper mg kg 0.94
dtpa iron mg kg 79.09
dtpa manganese mg kg 17.54
dtpa zinc mg kg 0.25
environment Soil
exc aluminium meq 100g 0.115
exc calcium meq 100g 3.82
exc magnesium meq 100g 1.43
exc potassium meq 100g 0.8
exc sodium meq 100g 0.8
fine sand 50.97
general ecological zone Coastal
gravel 5.0
ncbi bioproject accession PRJNA317932
ncbi biosample accession SAMN07488630
nitrate nitrogen mg kg 34.0
otu CAAAAGAGACCAAGTTCAGTGCCCAAGACTCTTGAAACAGATCCTGGGCCCTGTTCTTTAGTCCCACCCACACTTTGTGAACTGTTGACTGTCTCTGGCAGTTTTGCTCTAAAGTTGTCATCCTTTTCAGGTGACAATTTTAAAACAGGCTGCCGAAAGGGGTCTCCTTTGACTCATCATTATTTCTAACTCTATGCTTAAACATTACCGGTCTGAAACTCTTCATATTATAAAATGTGAAAACAACTTTTGACA
otucount 1
organic carbon 1.25
ph level cacl2 cacl2 4.9
ph level h2o h2o 5.8
phosphorus colwell mg kg 6.0
potassium colwell mg kg 396.0
sample id 102.100.100/19269
sample type Soil
sand 66.99
silt 15.58
slope 8.0
soil moisture 10.13
sulphur mg kg 14.8
texture 2.0
vegetation type Woodland
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Altitude out of range Passed
    Altitude value non-numeric Passed
    Altitude value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 12 missing properties
    Show/Hide 45 tests that have not been run

    Additional political boundaries information

    Area Management
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Global 200 priority ecoregions - Terrestrial Southern Australia Mallee and Woodlands
    NRM Regions 2010 Adelaide and Mount Lofty Ranges
    NRM Regions 2014 Adelaide and Mount Lofty Ranges
    NRM Regions 2015 Adelaide and Mount Lofty Ranges
    NRM Regions 2017 Adelaide and Mount Lofty Ranges
    NRM Regions 2017 (Qld 2019) Adelaide and Mount Lofty Ranges
    Area management
    National Landcare Program Management Units 2018 Adelaide and Mount Lofty Ranges
    Biodiversity
    IBRA 6 Regions Kanmantoo
    IBRA 6 Sub Regions Fleurieu
    IBRA 7 Regions Kanmantoo
    IBRA 7 Subregions Fleurieu
    Terrestrial Ecoregional Boundaries Mount Lofty Woodlands
    World Anthropogenic Biomes (2000) Populated croplands
    Climate
    Agroclimatic classification of Australia Classic "Mediterranean" climate with peaks of growth in winter and spring and moderate growth in winter
    Koppen Climate Classification (All Classes) Temperate: distinctly dry (and warm) summer
    Koppen Climate Classification (Major Classes) Temperate
    Hydrology
    Drainage Divisions Level 1 South Australian Gulf
    Drainage Divisions Level 2 FLEURIEU PENINSULA
    River Regions FLEURIEU PENINSULA
    Marine
    Marine Ecoregions of the World Western Bassian
    States including coastal waters South Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories South Australia
    Australian States and Territories South Australia
    Commonwealth Electoral Boundaries Mayo
    Local Government Areas 2011 Yankalilla (DC)
    Local Government Areas 2012 deprecated Yankalilla
    Local Government Areas PSMA 2018 THE DC OF YANKALILLA
    Native Title Determinations (13/7/2020) Ngarrindjeri and Others Native Title Claim SCD2017/002
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 28
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 717
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF SA
    PSMA ABS SA2 Statistical Areas (2016) YANKALILLA
    PSMA ABS SA3 Statistical Areas (2016) FLEURIEU - KANGAROO ISLAND
    PSMA ABS SA4 Statistical Areas (2016) SOUTH AUSTRALIA - SOUTH EAST
    PSMA Commonwealth Electoral Boundaries (2016) MAYO
    PSMA Commonwealth Electoral Boundaries (2018) MAYO
    PSMA Indigenous Areas (2016) FLEURIEU - KANGAROO ISLAND
    PSMA Indigenous Locations (2016) FLEURIEU - KANGAROO ISLAND
    PSMA Indigenous Regions (2016) ADELAIDE
    PSMA Localities (2018) CAPE JERVIS
    PSMA Remoteness Areas (2016) Inner Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (SA)
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) LEGISLATIVE COUNCIL
    PSMA States (2016) SOUTH AUSTRALIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (SA)
    PSMA Wards (2018) FIELD WARD
    Statistical Local Areas Yankalilla (DC)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Kanmantoo Region
    Surface Geology of Australia -Cykk
    Topography
    Physiographic Provinces of Australia Gulfs Ranges Province
    Physiographic Regions 2011 Flinders-Lofty Ranges
    Vegetation
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 7775071.0 $
    Area management
    Phosphorus 381.28558 t/ha
    Potassium 381.31714 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.8556
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.8347
    Endemism 0.015186212
    Endemism (Non-marine) 0.017245036
    Mammals – Fritz et al 2009 - 0.5 degree 0.2691
    Migratory species (2008) 13.0 frequency
    Occurrence Density 45176.0 frequency
    Shannon Diversity (H) 5.337476 index
    Species Richness 2057.0 frequency
    Threatened species (2008) 7.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.52779114
    2030A1BMk35M: Evaporation - month min 54.93 mm
    2030A1BMk35M: Precipitation - annual mean 43.16256 mm
    2030A1BMk35M: Precipitation - driest month 13.853571 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.0852114
    2030A1BMk35M: Precipitation - spring or autumn season 0.08447268
    2030A1BMk35M: Temperature - annual max mean 19.812857 degrees C
    2030A1BMk35M: Temperature - annual min mean 12.381965 degrees C
    2030A1BMk35M: Temperature - annual range 15.631409 degrees C
    Precipitation - annual 535.0 mm
    Precipitation - annual (Bio12) 564.0 mm
    Precipitation - coldest quarter (Bio19) 245.0 mm
    Precipitation - driest period (Bio14) 4.0 mm
    Precipitation - driest quarter (Bio17) 55.333332 mm
    Precipitation - seasonality (Bio15) 56.0 mm
    Precipitation - warmest quarter (Bio18) 55.5 mm
    Precipitation - wettest period (Bio13) 21.666666 mm
    Precipitation - wettest quarter (Bio16) 252.0 mm
    Radiation - annual mean (Bio20) 16.916666 MJ/m2/day
    Radiation - seasonality (Bio23) 43.166668
    Radiation - warmest quarter (Bio26) 24.849998 MJ/m2/day
    Temperature - annual mean (Bio01) 15.45 degrees C
    Temperature - annual range (Bio07) 15.866667 degrees C
    Temperature - coldest period min (Bio06) 8.266666 degrees C
    Temperature - coldest quarter mean (Bio11) 11.7 degrees C
    Temperature - diurnal range mean (Bio02) 7.366667 degrees C
    Temperature - driest quarter mean (Bio09) 19.216667 degrees C
    Temperature - isothermality (Bio03) 0.46333334 %
    Temperature - seasonality (Bio04) 1.0266666
    Temperature - warmest period max (Bio05) 24.1 degrees C
    Temperature - warmest quarter (Bio10) 19.233334 degrees C
    Temperature - wettest quarter mean (Bio08) 11.783333 degrees C
    Wind run - annual mean 356.48416 km/day
    WorldClim: Precipitation - annual 528.0 mm
    WorldClim: Precipitation - coldest quarter 232.0 mm
    WorldClim: Precipitation - driest month 14.0 mm
    WorldClim: Precipitation - driest quarter 49.0 mm
    WorldClim: Precipitation - seasonality 54.0
    WorldClim: Precipitation - warmest quarter 49.0 mm
    WorldClim: Precipitation - wettest month 82.0 mm
    WorldClim: Precipitation - wettest quarter 232.0 mm
    WorldClim: Temperature - annual mean 155.0 degrees C * 10
    WorldClim: Temperature - annual range 152.0 degrees C * 10
    WorldClim: Temperature - coldest month min 86.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 118.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 72.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 193.0 degrees C * 10
    WorldClim: Temperature - isothermality 47.0 %
    WorldClim: Temperature - seasonality 2946.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 238.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 193.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 118.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.089999996 degrees
    Distance - to coast 0.0 km x 100
    Distance - to non-permanent water (weighted) 0.089999996 degrees
    Distance - to permanent water (weighted) 0.17029385 km
    Euclidean Distance to Coast (metres) 1338.1715 m
    Remoteness index 3.7701728
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    GEOMACS - geometric mean 0.0 Pascals
    Sea Surface Temperature - MODIS Terra 16.83818 Degrees C
    SeaWIFS K490 Mean 0.09581159 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.7328368 mg/m^3
    Substrate
    2030A1BMk35M: Water stress index - month max 81.0
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 85.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.35 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 28.0 %
    Bulk density 1.5384234 Mg/m^3
    Clay % 50.61036 %
    Hydrologic conductivity - average saturated 13.333333 mm/h
    Moisture Index - annual mean (Bio28) 0.5133333
    Moisture Index - highest quarter mean (Bio32) 0.97333336
    Nutrient status 2.0 index
    Soil depth 1.2 m
    Soil pedality 3.8342342
    Water holding capacity 19250.0 mm
    Weathering Intensity V2 4.02967 Weathering Intensity Index
    Topography
    Aspect 224.0 degrees
    Averaged Topographic Relief 274.29166 metres
    Bathymetry and Topography 9 sec 0.0 m
    Elevation 46.0 m
    Topographic Slope (degrees) 2.6194782 degrees
    Topographic relief 29.35659 m
    Topographic slope (%) 5.611046 %
    Vegetation
    Fractional Cover - Bare Soil (2012-03-05) 58.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 30.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 13.0 % Persistent Vegetation
    NPP Mean 8.0 tonnes/ha/yr