Occurrence record: BOLD - Australian records - 3542770

GenomicDNA of ANGUILLIFORMES | True Eels recorded on 2006-06-29

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3542770
Other catalog numbers recordID:1438914;ProcessID:FOAK557-10;sampleID:BW-A8350
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
Collector/Observer K Graham (NSW Fisheries)
License CC-BY-Int
Field number GT 3569
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Ken Graham

Event

Field number GT 3569
Record date 2006-06-29
Date precision Day

Taxonomy

Scientific name ANGUILLIFORMES
Taxon rank order
Common name True Eels
Kingdom Animalia
Phylum Chordata
Class Actinopterygii
Order Anguilliformes
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province New South Wales
Locality E of Broken Bay
Latitude -33.5317
Longitude 151.508
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Marine

Additional properties

genbank accession HM902619
markercode COI-5P
nucleotides CCTATATTTAGTATTTGGTGCCTGAGCTGGCATGATTGGAACTGCTCTAAGCCTTCTAATTCGAGCCGAACTCAGCCAACCAGGAGCCCTACTTGGAGACGACCAAATTTATAATGTTATCGTTACGGCACACGCCTTTGTAATGATCTTCTTTATAGTAATACCAGTAATAATCGGAGGATTTGGTAATTGACTAATTCCACTAATGATTGGAGCTCCTGATATAGCATTCCCACGAATAAACAACATAAGCTTTTGACTCTTACCCCCGTCATTCCTCCTTCTATTAGCCTCTTCTGGAGTTGAAGCCGGAGCAGGGACAGGATGAACTGTATATCCCCCACTCGCCGGAAACTTGGCTCACGCCGGGGCCTCAGTAGATTTAACAATCTTCTCATTACACCTCGCAGGTATTTCATCCATTTTAGGGGCCATTAACTTCATCACCACAATTATTAATATGAAACCACCAGCCATTACGCAATACCAAACCCCACTATTTGTTTGAGCTGTATTAATTACAGCCGTACTACTACTTCTATCATTACCAGTTCTAGCCGCAGGCATTACAATGCTCCTCACAGACCGAAATTTAAACACCACATTCTTTGACCCGGCAGGAGGGGGGGACCCAATTCTTTACCAACA----
Owner institution code Biodiversity Institute of Ontario
sequence last updated 2011-11-14T08:11:16Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 13 missing properties
    Show/Hide 48 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Coral Ecoregions South-east Australia
    Area management
    National Landcare Program Management Units 2018 Marine NRM
    Biodiversity
    IMCRA 4 Regions Central Eastern Shelf Province
    IMCRA Meso-scale Bioregions Hawkesbury Shelf
    Marine
    FAO Fishery Statistical Areas 81
    Geomorphology of the Australian Margin and adjacent seafloor Shelf
    Global Seagrass Species Richness (2003) 5.00000000
    Marine Ecoregions of the World Manning-Hawkesbury
    Territorial Sea Territorial Sea

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.1175
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 0.0
    Endemism 0.034171052
    Endemism (Non-marine) 0.04480008
    Mammals – Fritz et al 2009 - 0.5 degree 0.2691
    Occurrence Density 1412.0 frequency
    Shannon Diversity (H) 5.9067755 index
    Species Richness 589.0 frequency
    Distance
    Euclidean Distance to Coast (metres) 3232.5168 m
    Marspec Distance to Shore 8.0 km
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    GEOMACS - geometric mean 0.01382 Pascals
    Marspec Annual Range in Sea Surface Salinity 0.24 100 x psu
    Marspec Annual Range in Sea Surface Temperature 5.43 100 x degrees C
    Marspec Annual Variance in Sea Surface Salinity 0.47 100 x psu
    Marspec Annual Variance in Sea Surface Temperature 3.7075 10,000 x degrees C
    Marspec Bathymetric Slope 0.2 10 x degrees
    Marspec Concavity -0.009000001 1000 x degrees
    Marspec East/West Aspect 1.0 radians
    Marspec Maximum Monthly Sea Surface Salinity 35.63 100 x psu
    Marspec Mean Annual Sea Surface Salinity 35.54 100 x psu
    Marspec Mean Annual Sea Surface Temperature 19.869999 100 x degrees C
    Marspec Minimum Monthly Sea Surface Salinity 35.39 100 x psu
    Marspec North/South Aspect 0.0 1 x radians
    Marspec Plan Curvature -2.9999999E-4 x 10000
    Marspec Profile Curvature 5.9999997E-4 x 10000
    Marspec Sea Surface Temperature of the coldest ice-free month 16.96 100 x degrees C
    Marspec Sea Surface Temperature of the warmest ice-free month 22.39 100 x degrees C
    Sea Surface Temperature - MODIS Terra 20.024572 Degrees C
    SeaWIFS K490 Mean 0.08509712 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.702531 mg/m^3
    Topography
    Averaged Topographic Relief 73.375 metres
    Bathymetry and Topography 9 sec -55.0 m
    Topographic Slope (degrees) 0.3535636 degrees