Occurrence record: BOLD - Australian records - 3744516

Material Sample of LEPIDOPTERA | Butterflies recorded on 2001-10-22
   API

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3744516
Other catalog numbers ["recordID:1650838;ProcessID:ANICJ154-10;sampleID:10ANIC-06151"]
Record type Material Sample
Supplied basis "MaterialSample"
Collector Common, I.F.B.  
Supplied as "I.F.B.Common"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Presence/Absence PRESENT

Event

Occurrence date 2001-10-22
Date precision DAY

Taxonomy

Scientific name LEPIDOPTERA
Identified to rank order
Common name Butterflies
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Name match metric exactMatch
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Queensland
Locality Solitude
Latitude -28.13
Supplied as: "-28.13"
Longitude 153.13
Supplied as: "153.13"
Datum EPSG:4326
Coordinate precision Unknown
Terrestrial true
Biome TERRESTRIAL
Marine false
Country Code AU

Additional properties

genbank accession HQ949480
markercode COI-5P
nucleotides AACATTATATTTTATTTTTGGTATTTGAGCTGGTATAGTAGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGATTGCTCCCCCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCATGGAGGAAGATCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGTGCTATTAATTTCATTACCACAATTATTAACATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACAGCATTTTTACTTCTTTTATCATTACCAGTATTAGCTGGAGCTATTACTATACTTTTAACCGATCGAAATTTAAATACTTCTTTTTTTGACCCAGCTGGTGGAGGAGATCCGATTCTTTATCAACATTTATTT
Owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:43Z

User flagged issues 

    Data quality tests

    Test name Result
    Coordinate uncertainty meters invalid Warning
    Geodetic datum assumed WGS84 Warning
    Name not supplied Warning
    Show/Hide 80 passed properties
    Show/Hide 7 missing properties
    Show/Hide 34 tests that have not been run

    Additional political boundaries information

    Area Management
    GER Border Ranges GER Border Ranges
    GER National Corridor GER National Corridor
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    NRM Regions 2010 South East Queensland
    NRM Regions 2017 South East Queensland
    Area management
    National Landcare Program Management Units 2018 South East Queensland
    Biodiversity
    IBRA 6 Regions South Eastern Queensland
    IBRA 7 Regions South Eastern Queensland
    IBRA 7 Subregions Scenic Rim
    Fire
    National Indicative Aggregated Fire Extent Dataset 2019-2020 - v20200324 National Indicative Aggregated Fire Extent 2019-2020
    Hydrology
    Drainage Divisions Level 1 North East Coast
    Drainage Divisions Level 2 LOGAN-ALBERT RIVERS
    Marine
    States including coastal waters Queensland (including Coastal Waters)
    Political
    ASGS Australian States and Territories Queensland
    Australian States and Territories Queensland
    Local Government Areas 2011 Scenic Rim (R)
    Local Government Areas 2012 deprecated Beaudesert - Pt B
    Local Government Areas PSMA 2018 SCENIC RIM REGIONAL
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 30
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 1225
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF QLD
    PSMA ABS SA2 Statistical Areas (2016) TAMBORINE - CANUNGRA
    PSMA ABS SA3 Statistical Areas (2016) GOLD COAST HINTERLAND
    PSMA ABS SA4 Statistical Areas (2016) GOLD COAST
    PSMA Commonwealth Electoral Boundaries (2018) WRIGHT
    PSMA Indigenous Areas (2016) BEAUDESERT - BOONAH
    PSMA Indigenous Locations (2016) BEAUDESERT - BOONAH
    PSMA Indigenous Regions (2016) BRISBANE
    PSMA Remoteness Areas (2016) Inner Regional Australia
    PSMA State Electoral Boundaries (2018) SCENIC RIM
    PSMA States (2016) QUEENSLAND
    World Country Boundaries Australia
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Forests of Australia 2018B Other native forest
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Unresolved Tenure
    Vegetation types - native Eucalypt woodlands
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Climate
    Precipitation - annual (Bio12) 1330.0 mm
    Precipitation - coldest quarter (Bio19) 174.0 mm
    Precipitation - driest period (Bio14) 8.0 mm
    Precipitation - driest quarter (Bio17) 139.0 mm
    Precipitation - seasonality (Bio15) 46.0 mm
    Precipitation - warmest quarter (Bio18) 515.0 mm
    Precipitation - wettest period (Bio13) 51.0 mm
    Precipitation - wettest quarter (Bio16) 515.0 mm
    Radiation - annual mean (Bio20) 17.3 MJ/m2/day
    Radiation - seasonality (Bio23) 25.0
    Radiation - warmest quarter (Bio26) 21.0 MJ/m2/day
    Temperature - annual mean (Bio01) 18.3 degrees C
    Temperature - annual range (Bio07) 21.8 degrees C
    Temperature - coldest period min (Bio06) 6.5 degrees C
    Temperature - coldest quarter mean (Bio11) 13.3 degrees C
    Temperature - diurnal range mean (Bio02) 11.4 degrees C
    Temperature - driest quarter mean (Bio09) 14.3 degrees C
    Temperature - isothermality (Bio03) 0.52 %
    Temperature - seasonality (Bio04) 1.26
    Temperature - warmest period max (Bio05) 28.3 degrees C
    Temperature - warmest quarter (Bio10) 22.6 degrees C
    Temperature - wettest quarter mean (Bio08) 22.6 degrees C
    WorldClim 2.1: Temperature - annual mean 18.270834 °C
    WorldClim: Temperature - isothermality 52.0 %
    Substrate
    Moisture Index - annual mean (Bio28) 0.9
    Moisture Index - highest quarter mean (Bio32) 1.0
    Elevation 299.0 m