Occurrence record:

EnvironmentalDNA of Clathrus ruber recorded on 2014-01-28

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2014-01-28
Date precision Day

Taxonomy

Scientific name Clathrus ruber
Taxon rank species
Kingdom Fungi
Phylum Basidiomycota
Class Agaricomycetes
Order Phallales
Family Phallaceae
Genus Clathrus
Species Clathrus ruber
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory New South Wales
Local government area Blue Mountains (C)
Locality Blackheath
Latitude -33.652974
Longitude 150.267825
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial
Verbatim elevation 1020.0

Additional properties

ammonium nitrogen mg kg 2.0
amplicon ITS1FITS4_fungi
boron hot cacl2 mg kg 0.48
broad land use Production from Dryland Agriculture and Plantations
clay 12.52
color GRBR
conductivity dsm ds m 0.051
course sand 69.91
depth m 0.0
detailed land use Production from Dryland Agriculture and Plantations - Perennial horticulture - Tree fruits - apple
dtpa copper mg kg 12.06
dtpa iron mg kg 123.77
dtpa manganese mg kg 6.77
dtpa zinc mg kg 14.42
environment Soil
exc aluminium meq 100g 0.092
exc calcium meq 100g 9.46
exc magnesium meq 100g 1.21
exc potassium meq 100g 0.45
exc sodium meq 100g 0.04
fine sand 11.26
general ecological zone Temperate
gravel 5.0
nitrate nitrogen mg kg 14.0
otu CTGAATTTATTTTCAAATCCCTTTCACACACCTGTGCACTCTAGCGCGAGGGGAGACCCTCCGCGTTTTTACAATACACCCTACGCCTGTCGTACGCATGCGATAAATAAAAAAAGTTTATATATAAAAACA
otucount 54
organic carbon 1.8
ph level cacl2 cacl2 5.1
ph level h2o h2o 5.9
phosphorus colwell mg kg 173.0
potassium colwell mg kg 176.0
sample id 102.100.100/12622
sample type Soil
sand 81.17
silt 6.31
slope 1.0
soil moisture 11.4168835998512
sulphur mg kg 4.1
texture 1.5
vegetation type Other
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Altitude out of range Passed
    Altitude value non-numeric Passed
    Altitude value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Habitat incorrect for species Passed
    Show/Hide 12 missing properties
    Show/Hide 44 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    GER National Corridor GER National Corridor
    GER Standard Boundary GER Standard Boundary
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    Irrigation practice - dominant No irrigation
    Land use Other minimal uses
    NRM Regions 2010 Hawkesbury-Nepean
    NRM Regions 2014 Greater Sydney
    NRM Regions 2015 Greater Sydney
    NRM Regions 2017 Greater Sydney
    NRM Regions 2017 (Qld 2019) Greater Sydney
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Greater Sydney
    Biodiversity
    Freshwater Ecoregions of the World Eastern Coastal Australia
    IBRA 6 Regions Sydney Basin
    IBRA 6 Sub Regions Wollemi
    IBRA 7 Regions Sydney Basin
    IBRA 7 Subregions Wollemi
    Terrestrial Ecoregional Boundaries Eastern Australian Temperate Forests
    World Anthropogenic Biomes (2000) Residential woodlands
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Koppen Climate Classification (All Classes) Temperate: no dry season (warm summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Eucalypt woodland (temperate)
    Hydrology
    Drainage Divisions Level 1 South East Coast (NSW)
    Drainage Divisions Level 2 HAWKESBURY RIVER
    River Regions HAWKESBURY RIVER
    Marine
    Marine Ecoregions of the World Manning-Hawkesbury
    States including coastal waters New South Wales (including Coastal Waters)
    Political
    ASGS Australian States and Territories New South Wales
    Australian States and Territories New South Wales
    Commonwealth Electoral Boundaries Macquarie
    Local Government Areas 2011 Blue Mountains (C)
    Local Government Areas 2012 deprecated Blue Mountains
    Local Government Areas PSMA 2018 BLUE MOUNTAINS CITY COUNCIL
    NSW Local Land Services Regions Greater Sydney
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 27
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 1817
    PSMA ABS Greater Capital City Statistical Areas (2016) GREATER SYDNEY
    PSMA ABS SA2 Statistical Areas (2016) BLACKHEATH - MEGALONG VALLEY
    PSMA ABS SA3 Statistical Areas (2016) BLUE MOUNTAINS
    PSMA ABS SA4 Statistical Areas (2016) SYDNEY - OUTER WEST AND BLUE MOUNTAINS
    PSMA Commonwealth Electoral Boundaries (2016) MACQUARIE
    PSMA Commonwealth Electoral Boundaries (2018) MACQUARIE
    PSMA Indigenous Areas (2016) BLUE MOUNTAINS
    PSMA Indigenous Locations (2016) BLUE MOUNTAINS - SURROUNDS
    PSMA Indigenous Regions (2016) SYDNEY - WOLLONGONG
    PSMA Localities (2018) BLACKHEATH
    PSMA Remoteness Areas (2016) Inner Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (NSW)
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) LEGISLATIVE COUNCIL
    PSMA States (2016) NEW SOUTH WALES
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (NSW)
    Statistical Local Areas Blue Mountains (C)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Sydney Region
    Surface Geology of Australia -Rsn
    Topography
    Physiographic Provinces of Australia Macquarie Uplands Province
    Physiographic Regions 2011 Hawkesbury-Shoalhaven Plateaus
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Native forest
    Forests of Australia (2013) v2.0 Eucalypt Medium Woodland
    Land cover Native forests and woodlands
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Modified
    Vegetation types - native Eucalypt open forests
    Vegetation types - present Eucalyptus open forest

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 8429158.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 1.0137
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 4.1971
    Endemism 0.041801363
    Endemism (Non-marine) 0.04505272
    Mammals – Fritz et al 2009 - 0.5 degree 0.4792
    Migratory species (2008) 5.0 frequency
    Occurrence Density 50968.0 frequency
    Shannon Diversity (H) 6.0267296 index
    Species Richness 3799.0 frequency
    Threatened communities (2008) 2.0 frequency
    Threatened species (2008) 13.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.833072
    2030A1BMk35M: Evaporation - month min 45.92 mm
    2030A1BMk35M: Precipitation - annual mean 88.791664 mm
    2030A1BMk35M: Precipitation - driest month 45.96 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.6994389
    2030A1BMk35M: Precipitation - spring or autumn season -0.4277677
    2030A1BMk35M: Temperature - annual max mean 18.506666 degrees C
    2030A1BMk35M: Temperature - annual min mean 8.305833 degrees C
    2030A1BMk35M: Temperature - annual range 22.809998 degrees C
    Aridity index - annual mean 1.1620146
    Aridity index - month max 2.875326
    Aridity index - month min 0.5203333
    Evaporation - annual mean 108.31389 (ml/5km x 5km pixel)
    Evaporation - average 19982.0 ml
    Evaporation - month max 199.8719 mm
    Evaporation - month min 36.167515 mm
    Evaporation - variability 7.0 %
    Growth index C3 macrotherm plants - annual mean 0.07 index
    Growth index C3 mesotherm plants - annual mean 0.39 index
    Growth index C4 megatherm plants - annual mean 0.04 index
    Humidity - annual mean relative 82.57616 %
    Humidity - annual mean relative 3pm 74.62769 %
    Humidity - month max relative 90.45249 %
    Humidity - month max relative 3pm 83.50633 %
    Humidity - month min relative 67.16937 %
    Humidity - month min relative 3pm 67.16937 %
    Precipitation - annual 1018.0 mm
    Precipitation - annual (Bio12) 1135.0 mm
    Precipitation - annual mean 100.65322 mm
    Precipitation - annual seasonality 0.37698582
    Precipitation - coldest quarter (Bio19) 207.0 mm
    Precipitation - driest month 67.0 mm
    Precipitation - driest period (Bio14) 13.0 mm
    Precipitation - driest quarter (Bio17) 201.0 mm
    Precipitation - equinox seasonality ratio 0.73884106
    Precipitation - seasonality (Bio15) 30.0 mm
    Precipitation - spring or autumn season -0.35203415
    Precipitation - warmest quarter (Bio18) 361.0 mm
    Precipitation - wettest month 142.6312 mm
    Precipitation - wettest period (Bio13) 34.0 mm
    Precipitation - wettest quarter (Bio16) 413.0 mm
    Radiation - annual mean (Bio20) 16.3 MJ/m2/day
    Radiation - seasonality (Bio23) 34.0
    Radiation - warmest quarter (Bio26) 21.8 MJ/m2/day
    Temperature - annual max mean 16.435 degrees C
    Temperature - annual mean (Bio01) 12.1 degrees C
    Temperature - annual min mean 6.3325 degrees C
    Temperature - annual range 22.66446 degrees C
    Temperature - annual range (Bio07) 22.8 degrees C
    Temperature - coldest month min 0.86 degrees C
    Temperature - coldest period min (Bio06) 1.4 degrees C
    Temperature - coldest quarter mean (Bio11) 6.4 degrees C
    Temperature - diurnal range mean (Bio02) 10.0 degrees C
    Temperature - driest quarter mean (Bio09) 7.0 degrees C
    Temperature - isothermality (Bio03) 0.44 %
    Temperature - month hottest maximum 22.96 degrees C
    Temperature - seasonality (Bio04) 1.55
    Temperature - warmest month min 11.69 degrees C
    Temperature - warmest period max (Bio05) 24.2 degrees C
    Temperature - warmest quarter (Bio10) 17.7 degrees C
    Temperature - wettest quarter mean (Bio08) 17.2 degrees C
    Wind run - annual mean 155.70549 km/day
    WorldClim: Precipitation - annual 1258.0 mm
    WorldClim: Precipitation - coldest quarter 254.0 mm
    WorldClim: Precipitation - driest month 60.0 mm
    WorldClim: Precipitation - driest quarter 208.0 mm
    WorldClim: Precipitation - seasonality 29.0
    WorldClim: Precipitation - warmest quarter 414.0 mm
    WorldClim: Precipitation - wettest month 158.0 mm
    WorldClim: Precipitation - wettest quarter 457.0 mm
    WorldClim: Temperature - annual mean 119.0 degrees C * 10
    WorldClim: Temperature - annual range 224.0 degrees C * 10
    WorldClim: Temperature - coldest month min 12.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 60.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 100.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 69.0 degrees C * 10
    WorldClim: Temperature - isothermality 44.0 %
    WorldClim: Temperature - seasonality 4432.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 236.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 173.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 170.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.9231468 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.07810249 km
    Euclidean Distance to Coast (metres) 49559.87 m
    Remoteness index 0.37
    Hydrology
    Drainage - average 2463.0 megalitres/5x5km/year
    Drainage - variability 92.0 %
    Runoff - average 2838.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) -9955.636 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 80.21984
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 71.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.5 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 10.0 %
    Bulk density 1.3318447 Mg/m^3
    Carbon - organic 2.5694253 %
    Clay % 17.031553 %
    Hydrologic conductivity - average saturated 55.454544 mm/h
    Moisture Index - annual mean (Bio28) 0.89
    Moisture Index - highest quarter mean (Bio32) 1.0
    Nutrient status 1.0 index
    Ph - soil 4.0 ph
    Soil depth 1.1 m
    Soil pedality 1.8737864
    Water holding capacity 37750.0 mm
    Water stress index - month max 81.0
    Weathering Intensity V2 1.32463 Weathering Intensity Index
    Topography
    Aspect 331.0 degrees
    Averaged Topographic Relief 465.66666 metres
    Bathymetry and Elvation 9 sec 1022.0 m
    Elevation 1009.0 m
    Topographic Slope (degrees) 8.151555 degrees
    Topographic relief 215.9365 m
    Topographic slope (%) 17.77576 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3668 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 43.0 %
    Fractional Cover - Bare Soil (2012-03-05) 0.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 9.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 91.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0287 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 1.0 m^2 plant / m^2 ground
    NDVI Mean 74.0 NDVI x 100
    NPP Mean 9.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.804 NDVI