Occurrence record: BOLD - Australian records - 3643118

GenomicDNA of Oenosandra boisduvalii recorded on 1969-12-31

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3643118
Other catalogue numbers recordID:1331366;ProcessID:LEFIA1261-10;sampleID:MM07590
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Field number MM07590
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Marko Mutanen

Event

Field number MM07590
Record date 1969-12-31
Date precision Day

Taxonomy

Scientific name Oenosandra boisduvalii
Taxon rank species
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Family Oenosandridae
Genus Oenosandra
Species Oenosandra boisduvalii
Taxonomic issues No issues
Name match metric Canonical name match
The supplied name was parsed into canonical form before a match was found.
Name parse type SCIENTIFIC

Geospatial

Country Australia

Additional properties

markercode COI-5P
nucleotides GAACTTTATATTTTATTTTTGGSATTTGAGCTGGTATAGTTGGAA----T-TAAGTTTATTAATTCGAGCAGAATTAGGAAATCCCGGATCTTTAATTGGAGACGATCAAATTTATAATACTATTGTAACAGCTCATGCCTTTATTATAATTTTTTTTATGGTTATACCAATTATAATTGGAGGGTTTGGTAATTGATTAGTTCCCCTAATATTAGGAGCTCCAGATATGGCTTTCCCACGAATAAATAATATAAGTTTTTGATTACTCCCCCCCTCCTTAACTCTTTTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCTCATGGTGGTAGATCTGTGGATTTAGCCATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCAATTAATTTTATTACAACAATCATTAATATGCGATTAAATAATATATCATTCGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACTGCTCTTCTTCTCTTACTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGTAATTTAAATACATCTTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATACCAACACTTATTTTGATTTTTTGG
owner institution code University of Oulu
sequence last updated 2011-11-14T08:11:45Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Show/Hide 14 missing properties
    Show/Hide 58 tests that have not been run