Occurrence record:

EnvironmentalDNA of Fungi recorded on 2012-11-15

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2012-11-15
Date precision Day

Taxonomy

Scientific name Fungi
Taxon rank kingdom
Kingdom Fungi
Phylum Fungi unclassified
Class Fungi unclassified
Order Fungi unclassified
Family Fungi unclassified
Genus Fungi unclassified
Species Fungi unclassified
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province South Australia
Locality Wudinna (DC)
Locality Minnipa
Latitude -32.834625
Longitude 135.155703
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial
Verbatim elevation 185.0

Additional properties

ammonium nitrogen mg kg 3.0
amplicon ITS1FITS4_fungi
australian soil classification Calcarosols
boron hot cacl2 mg kg 1.27
broad land use Production from Dryland Agriculture and Plantations
color BRGR
conductivity dsm ds m 0.092
depth m 0.0
detailed land use Production from Dryland Agriculture and Plantations - Cropping - Cereals - wheat
dtpa copper mg kg 0.41
dtpa iron mg kg 2.93
dtpa manganese mg kg 7.78
dtpa zinc mg kg 1.26
environment Soil
exc aluminium meq 100g 0.061
exc calcium meq 100g 12.44
exc magnesium meq 100g 1.3
exc potassium meq 100g 1.35
exc sodium meq 100g 0.11
general ecological zone Mediterranean
gravel 0.0
nitrate nitrogen mg kg 1e-10
otu CAAAATGATTGCTTTCGGTTTAAATTCCCCTCGGGTAGAGTTTAAACCAAAGCACACTTACCACTGTGCAATGAACCGTCTTTTTGGGTGTCTTGCTTCTTTCTGGTTAGCGGTTCTAGTCAACCGTGGGTCAGGACTGAGTGGGTGCCCATGAACGATTAACCAATTATAAATTTTAAACTGAACTTAAATATAAATTTAAA
otucount 12
organic carbon 0.86
ph level cacl2 cacl2 7.6
ph level h2o h2o 8.7
phosphorus colwell mg kg 32.0
potassium colwell mg kg 528.0
sample id 102.100.100/8217
sample type Soil
soil moisture 7.0
sulphur mg kg 2.4
texture 2.0
vegetation type Other
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Altitude out of range Passed
    Altitude value non-numeric Passed
    Altitude value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 12 missing properties
    Show/Hide 45 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) Fallow 3-9 months
    Fallow practice - dominant (number) Fallow 3-9 months
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Global 200 priority ecoregions - Terrestrial Southern Australia Mallee and Woodlands
    Irrigation practice - dominant No irrigation
    Land use Cropping
    NRM Regions 2010 Eyre Peninsula
    NRM Regions 2014 Eyre Peninsula
    NRM Regions 2015 Eyre Peninsula
    NRM Regions 2017 Eyre Peninsula
    NRM Regions 2017 (Qld 2019) Eyre Peninsula
    Stubble practice - dominant (area) Stubble ploughed in
    Stubble practice - dominant (number) Stubble ploughed in
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 Eyre Peninsula
    Biodiversity
    Freshwater Ecoregions of the World Paleo
    IBRA 6 Regions Eyre Yorke Block
    IBRA 6 Sub Regions Eyre Mallee
    IBRA 7 Regions Eyre Yorke Block
    IBRA 7 Subregions Eyre Mallee
    Terrestrial Ecoregional Boundaries Eyre And York Mallee
    World Anthropogenic Biomes (2000) Populated croplands
    Climate
    Agroclimatic classification of Australia "Mediterranean" climate, but with drier cooler winters and less growth than Classic "Mediterranean" climate
    Koppen Climate Classification (All Classes) Grassland: warm (summer drought)
    Koppen Climate Classification (Major Classes) Grassland
    Fire
    Fire regime niches Pasture, cropland (temperate)
    Hydrology
    Drainage Divisions Level 1 South Western Plateau
    Drainage Divisions Level 2 GAIRDNER
    River Regions GAIRDNER
    Marine
    Marine Ecoregions of the World South Australian Gulfs
    States including coastal waters South Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories South Australia
    Australian States and Territories South Australia
    Commonwealth Electoral Boundaries Grey
    Local Government Areas 2011 Wudinna (DC)
    Local Government Areas 2012 deprecated Le Hunte
    Local Government Areas PSMA 2018 WUDINNA DISTRICT COUNCIL
    Native Title Determinations (13/7/2020) Barngarla Native Title Claim SCD2016/001
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 194
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 697
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF SA
    PSMA ABS SA2 Statistical Areas (2016) LE HUNTE - ELLISTON
    PSMA ABS SA3 Statistical Areas (2016) EYRE PENINSULA AND SOUTH WEST
    PSMA ABS SA4 Statistical Areas (2016) SOUTH AUSTRALIA - OUTBACK
    PSMA Commonwealth Electoral Boundaries (2016) GREY
    PSMA Commonwealth Electoral Boundaries (2018) GREY
    PSMA Indigenous Areas (2016) CEDUNA - WEST COAST
    PSMA Indigenous Locations (2016) EYRE PENINSULA
    PSMA Indigenous Regions (2016) PORT LINCOLN - CEDUNA
    PSMA Localities (2018) MINNIPA
    PSMA Remoteness Areas (2016) Very Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (SA)
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) LEGISLATIVE COUNCIL
    PSMA States (2016) SOUTH AUSTRALIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (SA)
    Statistical Local Areas Wudinna (DC)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Gawler Region
    Surface Geology of Australia Qdwi
    Topography
    Physiographic Provinces of Australia Eyre Peninsula Province
    Physiographic Regions 2011 Eyre Dunefield
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Built-up
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Other Crown Land
    Vegetation - condition Replaced
    Vegetation types - native Mallee woodlands and shrublands
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 3070893.0 $
    Area management
    Phosphorus 0.011202 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.8219
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 0.0
    Endemism 0.020498054
    Endemism (Non-marine) 0.02103157
    Mammals – Fritz et al 2009 - 0.5 degree 0.0
    Migratory species (2008) 3.0 frequency
    Occurrence Density 3186.0 frequency
    Shannon Diversity (H) 5.6937966 index
    Species Richness 726.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 5.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.19453904
    2030A1BMk35M: Evaporation - month min 67.23 mm
    2030A1BMk35M: Precipitation - annual mean 22.789165 mm
    2030A1BMk35M: Precipitation - driest month 10.06 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.4785947
    2030A1BMk35M: Precipitation - spring or autumn season 0.4695799
    2030A1BMk35M: Temperature - annual max mean 25.2625 degrees C
    2030A1BMk35M: Temperature - annual min mean 11.5625 degrees C
    2030A1BMk35M: Temperature - annual range 25.970001 degrees C
    Aridity index - annual mean 0.2383895
    Aridity index - month max 0.63989705
    Aridity index - month min 0.038962174
    Evaporation - annual mean 185.49165 (ml/5km x 5km pixel)
    Evaporation - average 7551.0 ml
    Evaporation - month max 333.65695 mm
    Evaporation - month min 65.63556 mm
    Evaporation - variability 21.0 %
    Growth index C3 macrotherm plants - annual mean 0.03 index
    Growth index C3 mesotherm plants - annual mean 0.13 index
    Growth index C4 megatherm plants - annual mean 0.02 index
    Humidity - annual mean relative 76.117226 %
    Humidity - annual mean relative 3pm 60.190193 %
    Humidity - month max relative 88.96921 %
    Humidity - month max relative 3pm 74.252846 %
    Humidity - month min relative 48.13508 %
    Humidity - month min relative 3pm 48.13508 %
    Precipitation - annual 320.0 mm
    Precipitation - annual (Bio12) 307.0 mm
    Precipitation - annual mean 27.553698 mm
    Precipitation - annual seasonality -0.87644225
    Precipitation - coldest quarter (Bio19) 125.0 mm
    Precipitation - driest month 13.0 mm
    Precipitation - driest period (Bio14) 2.0 mm
    Precipitation - driest quarter (Bio17) 34.0 mm
    Precipitation - equinox seasonality ratio 1.1832519
    Precipitation - seasonality (Bio15) 48.0 mm
    Precipitation - spring or autumn season 0.18063398
    Precipitation - warmest quarter (Bio18) 39.0 mm
    Precipitation - wettest month 45.0 mm
    Precipitation - wettest period (Bio13) 11.0 mm
    Precipitation - wettest quarter (Bio16) 125.0 mm
    Radiation - annual mean (Bio20) 19.0 MJ/m2/day
    Radiation - seasonality (Bio23) 37.0
    Radiation - warmest quarter (Bio26) 26.8 MJ/m2/day
    Temperature - annual max mean 23.346666 degrees C
    Temperature - annual mean (Bio01) 17.4 degrees C
    Temperature - annual min mean 9.963333 degrees C
    Temperature - annual range 25.0 degrees C
    Temperature - annual range (Bio07) 26.3 degrees C
    Temperature - coldest month min 5.82 degrees C
    Temperature - coldest period min (Bio06) 6.2 degrees C
    Temperature - coldest quarter mean (Bio11) 11.8 degrees C
    Temperature - diurnal range mean (Bio02) 13.5 degrees C
    Temperature - driest quarter mean (Bio09) 22.4 degrees C
    Temperature - isothermality (Bio03) 0.51 %
    Temperature - month hottest maximum 31.03 degrees C
    Temperature - seasonality (Bio04) 1.52
    Temperature - warmest month min 14.49 degrees C
    Temperature - warmest period max (Bio05) 32.5 degrees C
    Temperature - warmest quarter (Bio10) 23.1 degrees C
    Temperature - wettest quarter mean (Bio08) 11.9 degrees C
    Wind run - annual mean 238.51558 km/day
    WorldClim: Precipitation - annual 336.0 mm
    WorldClim: Precipitation - coldest quarter 139.0 mm
    WorldClim: Precipitation - driest month 9.0 mm
    WorldClim: Precipitation - driest quarter 36.0 mm
    WorldClim: Precipitation - seasonality 47.0
    WorldClim: Precipitation - warmest quarter 40.0 mm
    WorldClim: Precipitation - wettest month 49.0 mm
    WorldClim: Precipitation - wettest quarter 139.0 mm
    WorldClim: Temperature - annual mean 165.0 degrees C * 10
    WorldClim: Temperature - annual range 251.0 degrees C * 10
    WorldClim: Temperature - coldest month min 53.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 110.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 132.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 216.0 degrees C * 10
    WorldClim: Temperature - isothermality 52.0 %
    WorldClim: Temperature - seasonality 4205.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 304.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 218.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 110.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.4295346 degrees
    Distance - to coast 0.5700877 km x 100
    Distance - to non-permanent water (weighted) 0.4295346 degrees
    Distance - to permanent water (weighted) 1.3978555 km
    Euclidean Distance to Coast (metres) 53280.043 m
    Remoteness index 12.588059
    Hydrology
    Drainage - average 22.0 megalitres/5x5km/year
    Drainage - variability 149.0 %
    Runoff - average 0.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 0.2 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 52.489956
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 94.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.41 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 21.0 %
    Bulk density 1.540777 Mg/m^3
    Carbon - organic 0.6787083 %
    Clay % 28.488176 %
    Hydrologic conductivity - average saturated 60.0 mm/h
    Moisture Index - annual mean (Bio28) 0.22
    Moisture Index - highest quarter mean (Bio32) 0.5
    Nutrient status 1.0 index
    Ph - soil 6.0 ph
    Soil depth 0.8 m
    Soil pedality 2.0679054
    Water holding capacity 27000.0 mm
    Water stress index - month max 57.590733
    Weathering Intensity V2 4.53579 Weathering Intensity Index
    Topography
    Aspect 281.0 degrees
    Averaged Topographic Relief 60.666668 metres
    Bathymetry and Topography 9 sec 163.0 m
    Elevation 160.0 m
    Topographic Slope (degrees) 0.51787835 degrees
    Topographic relief 8.427185 m
    Topographic slope (%) 0.6237118 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.1345 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 15.0 %
    Fractional Cover - Bare Soil (2012-03-05) 55.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 35.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 10.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0051 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.2 m^2 plant / m^2 ground
    NDVI Mean 32.0 NDVI x 100
    NPP Mean 2.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.2322 NDVI