Occurrence record: BOLD - Australian records - 3494988

GenomicDNA of Gracilariales recorded on 2010-01-24

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3494988
Other catalog numbers recordID:1367283;ProcessID:ABMMC7902-10;sampleID:GWS015983
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
Collector/Observer Saunders, G.W.|Dixon, K.
Supplied as "G.W. Saunders & K. Dixon"
License CC-BY-Int
Field number GWS015983
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Gary Saunders

Event

Field number GWS015983
Record date 2010-01-24
Date precision Day

Taxonomy

Scientific name Gracilariales
Taxon rank order
Kingdom Plantae
Phylum Rhodophyta
Class Florideophyceae
Order Gracilariales
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province Tasmania
Locality West Coast (M)
Locality Hells Gates (beach to north)
Latitude -42.217
Longitude 145.223
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Marine

Additional properties

genbank accession HM917980
markercode COI-5P
nucleotides TACTTTATATTTAATTTTTGGTGCTTTCTCTGGTATATTAGGTGGTTGTATGTCGATGCTAATTCGTATGGAATTGGCTCAGCCTGGAAATCAATTATTGTTAGGAAATCATCAAATTTATAATGTTTTAATTACAGCACACGCTTTTTTAATGATTTTTTTTATGGTAATGCCTGTTATGATTGGAGGGTTTGGAAATTGATTAGTTCCTATTATGATAGGCAGTCCCGATATGGCTTTTCCTCGTTTAAATAATATATCATTTTGATTATTACCGCCTTCTCTTTGTCTACTTTTAGCATCAGCAATTGTAGAAGTAGGTGTAGGTACAGGATGAACTGTATATCCCCCACTTAGTTCAATTCAAAGCCATTCTGGCGGTGCTGTAGATTTAGCGATTTTCAGTTTACATATTTCTGGTGCATCTTCAATTTTAGGTGCTATTAATTTTATTTCTACAATTTTAAATATGCGTAATCCAGGGCAAAGTATGTATCGTATGCCTTTGTTTGTATGATCAATTTTTATTACGGCATTTCTATTGTTATTAGCTGTCCCTGTTTTAGCTGGTGCCATTACAATGCTTTTGACTGATCGTAATTTTAATACAGCATTTTTTGATCCTGCAGGAGGAGGAGATCCTGTATTATATCAGCATCTTTTT
Owner institution code University of New Brunswick, Fredericton
sequence last updated 2011-11-14T08:11:41Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    CAPAD 2012 Terrestrial Ocean Beach
    CAPAD 2014 Terrestrial Ocean Beach
    CAPAD 2016 Terrestrial Ocean Beach
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Global 200 priority ecoregions - Terrestrial Tasmanian Temperate Rainforests
    Important Bird Areas (IBA) Australia North-west Tasmanian Coast IBA
    Irrigation practice - dominant No irrigation
    Land use Nature conservation
    NRM Regions 2010 North West
    NRM Regions 2014 North West TAS
    NRM Regions 2015 North West
    NRM Regions 2017 North West NRM Region
    NRM Regions 2017 (Qld 2019) North West NRM Region
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 North West NRM Region
    Biodiversity
    IMCRA 4 Regions Tasmanian Shelf Province
    IMCRA Meso-scale Bioregions Franklin
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Koppen Climate Classification (All Classes) Temperate: no dry season (mild summer)
    Koppen Climate Classification (Major Classes) Temperate
    Hydrology
    Drainage Divisions Level 1 Tasmania
    Drainage Divisions Level 2 KING-HENTY RIVERS
    River Regions KING-HENTY RIVERS
    Marine
    Estuary habitat mapping 30750 Macquarie Harbour Barrier/back-barrier
    FAO Fishery Statistical Areas 57
    Marine Ecoregions of the World Bassian
    States including coastal waters Tasmania (including Coastal Waters)
    Political
    ASGS Australian States and Territories Tasmania
    Commonwealth Electoral Boundaries Braddon
    Local Government Areas 2011 West Coast (M)
    Local Government Areas PSMA 2018 WEST COAST COUNCIL
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 3
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 3932
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF TAS.
    PSMA ABS SA2 Statistical Areas (2016) WEST COAST (TAS.)
    PSMA ABS SA3 Statistical Areas (2016) WEST COAST
    PSMA ABS SA4 Statistical Areas (2016) WEST AND NORTH WEST
    PSMA Commonwealth Electoral Boundaries (2016) BRADDON
    PSMA Commonwealth Electoral Boundaries (2018) BRADDON
    PSMA Indigenous Areas (2016) TASMANIA - WEST COAST
    PSMA Indigenous Locations (2016) ZEEHAN - FRANKLIN
    PSMA Indigenous Regions (2016) TASMANIA
    PSMA Localities (2018) STRAHAN
    PSMA Remoteness Areas (2016) Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (TAS.)
    PSMA State Electoral Boundaries (2016) MURCHISON
    PSMA State Electoral Boundaries (2018) MURCHISON
    PSMA States (2016) TASMANIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (TAS.)
    Statistical Local Areas West Coast (M)
    Substrate
    Geological Regions of Australia Dundas Region
    Vegetation
    NVIS 4.1 Major Vegetation Groups Naturally bare - sand, rock, claypan, mudflat
    NVIS 4.1 Major Vegetation Subgroups Naturally bare, sand, rock, claypan, mudflat
    Vegetation types - native Low closed forests and closed shrublands
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure - additional 1.0 $/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.4151
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.2931
    Endemism 0.036054146
    Endemism (Non-marine) 0.040618375
    Mammals – Fritz et al 2009 - 0.5 degree 0.2867
    Occurrence Density 3037.0 frequency
    Shannon Diversity (H) 5.4409027 index
    Species Richness 590.0 frequency
    Threatened communities (2008) 0.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 2.3582551
    2030A1BMk35M: Aridity index - month max 5.177617
    2030A1BMk35M: Aridity index - month min 0.56500274
    2030A1BMk35M: Evaporation - annual mean 70.3325 mm
    2030A1BMk35M: Evaporation - month max 121.35 mm
    2030A1BMk35M: Evaporation - month min 31.72 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.07 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.5 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.05 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 84.99275 %
    2030A1BMk35M: Humidity - month max relative 3pm 90.454765 %
    2030A1BMk35M: Humidity - month min relative 3pm 79.0769 %
    2030A1BMk35M: Precipitation - annual mean 115.559166 mm
    2030A1BMk35M: Precipitation - driest month 61.8 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.0199386
    2030A1BMk35M: Precipitation - max difference between successive months 0.9670859 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -1.173387 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 0.47238442
    2030A1BMk35M: Precipitation - spring or autumn season 0.01987867
    2030A1BMk35M: Precipitation - summer or winter season -1.1120791
    2030A1BMk35M: Precipitation - wettest month 164.86 mm
    2030A1BMk35M: Precipitation deficit - annual mean 45.226665 mm
    2030A1BMk35M: Precipitation deficit - month max -47.579998 mm
    2030A1BMk35M: Precipitation deficit - month min 132.89 mm
    2030A1BMk35M: Radiation - max month precipitation modified 20.88 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 12.13 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 3.85 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 16.684166 degrees C
    2030A1BMk35M: Temperature - annual min mean 9.384167 degrees C
    2030A1BMk35M: Temperature - annual range 14.199982 degrees C
    2030A1BMk35M: Temperature - coldest month min 6.77 degrees C
    2030A1BMk35M: Temperature - coolest month max 12.84 degrees C
    2030A1BMk35M: Temperature - max difference in max 1.8099976 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 1.2200012 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 8.72998 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 7.299998 degrees C
    2030A1BMk35M: Temperature - min difference in max -2.1100159 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -1.7099915 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 6.029999 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 20.97 degrees C
    2030A1BMk35M: Temperature - warmest month min 12.24 degrees C
    Aridity index - annual mean 2.4767768
    Aridity index - month max 5.7
    Aridity index - month min 0.59690493
    Evaporation - annual mean 73.64095 (ml/5km x 5km pixel)
    Evaporation - month max 135.7 mm
    Evaporation - month min 27.6 mm
    Growth index C3 macrotherm plants - annual mean 0.04 index
    Growth index C3 mesotherm plants - annual mean 0.42 index
    Growth index C4 megatherm plants - annual mean 0.03 index
    Humidity - annual mean relative 87.75818 %
    Humidity - annual mean relative 3pm 84.23568 %
    Humidity - month max relative 89.58101 %
    Humidity - month max relative 3pm 89.47339 %
    Humidity - month min relative 78.67803 %
    Humidity - month min relative 3pm 78.67803 %
    Precipitation - annual (Bio12) 1475.0 mm
    Precipitation - annual (log) seasonality index -0.07280538
    Precipitation - annual mean 122.023415 mm
    Precipitation - annual seasonality -0.5866045
    Precipitation - annual seasonality ratio 0.6298653
    Precipitation - coldest quarter (Bio19) 497.0 mm
    Precipitation - driest month 74.468704 mm
    Precipitation - driest period (Bio14) 16.0 mm
    Precipitation - driest quarter (Bio17) 248.0 mm
    Precipitation - equinox seasonality ratio 0.980975
    Precipitation - max difference between successive months 1.2192891 mm/day
    Precipitation - min difference between successive months -0.7714733 mm/day
    Precipitation - seasonality (Bio15) 27.0 mm
    Precipitation - solstice seasonality ratio 0.5117234
    Precipitation - spring or autumn (log) season -0.003251445
    Precipitation - spring or autumn season -0.019340444
    Precipitation - summer or winter (log) season -0.120990776
    Precipitation - summer or winter season -0.95036304
    Precipitation - warmest quarter (Bio18) 248.0 mm
    Precipitation - wettest month 171.0 mm
    Precipitation - wettest period (Bio13) 42.0 mm
    Precipitation - wettest quarter (Bio16) 497.0 mm
    Precipitation deficit - annual mean 48.38246 mm
    Precipitation deficit - month max -54.699997 mm
    Precipitation deficit - month min 141.0 mm
    Radiation - annual mean (Bio20) 11.9 MJ/m2/day
    Radiation - coldest quarter (Bio27) 5.3 MJ/m2/day
    Radiation - driest quarter (Bio25) 18.2 MJ/m2/day
    Radiation - highest period (Bio21) 20.9 MJ/m2/day
    Radiation - lowest period (Bio22) 3.6 MJ/m2/day
    Radiation - max month precipitation modified 20.9 MJ/m2/day
    Radiation - mean annual precipitation modified 11.958333 MJ/m2/day
    Radiation - min month precipitation modified 3.9 MJ/m2/day
    Radiation - seasonality (Bio23) 54.0
    Radiation - warmest quarter (Bio26) 18.9 MJ/m2/day
    Radiation - wettest quarter (Bio24) 5.3 MJ/m2/day
    Temperature - annual max mean 15.514167 degrees C
    Temperature - annual mean (Bio01) 12.3 degrees C
    Temperature - annual min mean 8.001667 degrees C
    Temperature - annual range 14.299988 degrees C
    Temperature - annual range (Bio07) 14.3 degrees C
    Temperature - coldest month min 5.37 degrees C
    Temperature - coldest period min (Bio06) 6.0 degrees C
    Temperature - coldest quarter mean (Bio11) 9.4 degrees C
    Temperature - coolest month max 11.6 degrees C
    Temperature - diurnal range mean (Bio02) 7.2 degrees C
    Temperature - driest quarter mean (Bio09) 15.3 degrees C
    Temperature - isothermality (Bio03) 0.51 %
    Temperature - max absolute mean max 38.0 degrees C
    Temperature - max difference in max 1.6000061 degrees C/day
    Temperature - max difference in min 1.2999878 degrees C/day
    Temperature - max month diurnal range 9.180023 degrees C
    Temperature - mean annual absolute mean min 0.27078333 degrees C
    Temperature - mean annual diurnal range 7.512502 degrees C
    Temperature - min absolute mean min -2.768 degrees C
    Temperature - min difference in max -2.2799988 degrees C/day
    Temperature - min difference in min -1.7399902 degrees C/day
    Temperature - min month diurnal range 6.230011 degrees C
    Temperature - month hottest maximum 19.86 degrees C
    Temperature - month mean absolute max 30.2083 degrees C
    Temperature - seasonality (Bio04) 0.81
    Temperature - warmest month min 10.68 degrees C
    Temperature - warmest period max (Bio05) 20.3 degrees C
    Temperature - warmest quarter (Bio10) 15.3 degrees C
    Temperature - wettest quarter mean (Bio08) 9.4 degrees C
    Vapour pressure deficit - annual mean 0.045124333 KPa
    Vapour pressure deficit - annual mean 9am 0.18007462 KPa
    Vapour pressure deficit - month max 0.27885377 KPa
    Vapour pressure deficit - month max 9am 0.27885377 KPa
    Vapour pressure deficit - month min 0.0 KPa
    Vapour pressure deficit - month min 9am 0.11554921 KPa
    Wind run - annual mean 155.94366 km/day
    Wind run - month max 183.4 km/day
    Wind run - month min 134.6 km/day
    Wind speed - annual mean 3pm 3.4080973 m/s
    Wind speed - annual mean 9am 2.325 m/s
    Wind speed - annual mean 9am or 3pm 3.55 m/s
    Wind speed - month max 3pm 4.1 m/s
    Wind speed - month max 9am 3.0 m/s
    Wind speed - month max 9am or 3pm 4.1 m/s
    Wind speed - month min 3pm 2.6 m/s
    Wind speed - month min 9am 1.8 m/s
    Wind speed - month min 9am or 3pm 1.8 m/s
    Distance
    Distance - to any water (weighted) 0.12529963 degrees
    Distance - to coast 0.01 km x 100
    Distance - to non-permanent water (weighted) 0.829759 degrees
    Distance - to permanent water (weighted) 0.12529963 km
    Euclidean Distance to Coast (metres) 10043.545 m
    Marspec Distance to Shore 1.0 km
    Hydrology
    Water Observations From Space 6.25 Percentage
    Marine
    GEOMACS - geometric mean 2.559142 Pascals
    Marspec Annual Range in Sea Surface Salinity 0.41 100 x psu
    Marspec Annual Range in Sea Surface Temperature 4.7 100 x degrees C
    Marspec Annual Variance in Sea Surface Salinity 1.17 100 x psu
    Marspec Annual Variance in Sea Surface Temperature 2.4947 10,000 x degrees C
    Marspec Bathymetric Slope 0.0 10 x degrees
    Marspec Concavity 0.001 1000 x degrees
    Marspec East/West Aspect 0.71 radians
    Marspec Maximum Monthly Sea Surface Salinity 35.23 100 x psu
    Marspec Mean Annual Sea Surface Salinity 35.03 100 x psu
    Marspec Mean Annual Sea Surface Temperature 13.719999 100 x degrees C
    Marspec Minimum Monthly Sea Surface Salinity 34.82 100 x psu
    Marspec North/South Aspect 0.71 1 x radians
    Marspec Plan Curvature 0.0 x 10000
    Marspec Profile Curvature -1.0E-4 x 10000
    Marspec Sea Surface Temperature of the coldest ice-free month 11.509999 100 x degrees C
    Marspec Sea Surface Temperature of the warmest ice-free month 16.21 100 x degrees C
    Sea Surface Temperature - MODIS Terra 13.87023 Degrees C
    SeaWIFS K490 Mean 0.2664636 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 4.9900913 mg/m^3
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.9
    2030A1BMk35M: Crop factor - month max 0.90000004
    2030A1BMk35M: Crop factor - month min 0.9
    2030A1BMk35M: Water deficit - month max 0.0 mm
    2030A1BMk35M: Water deficit - month mean 0.0 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -0.051892728 MPa
    2030A1BMk35M: Water potential - month max -2.8643754E-14 MPa
    2030A1BMk35M: Water potential - month min -0.2779187 MPa
    2030A1BMk35M: Water stress index - annual mean 81.0
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 80.99999
    2030A1BMk35M: Water surplus - annual mean 52.25992 mm
    2030A1BMk35M: Water surplus - month max 136.07101 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    Bouguer gravity anomalies 142.0265 Gal
    Bulk density 1.3719863 Mg/m^3
    Calcrete 0.0 presence
    Carbon store pre-European 91.2319 kgC/ha
    Clay % 14.37443 %
    Crop factor - annual mean 0.9
    Crop factor - month max 0.90000004
    Crop factor - month min 0.8999999
    Erosional surfaces - proportion 12.5 %
    Hydrologic conductivity - average saturated 183.33333 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 2.588 my
    Lithology - fertility 4.181818 index
    Lithology - mean age 1.294 my
    Lithology - mean age (log) 0.11193429 log my
    Lithology - mean age range (log) 0.41296428 log my
    Magnetic anomalies -46.0 nT
    Moisture Index - annual mean (Bio28) 0.96
    Moisture Index - coldest quarter mean (Bio35) 1.0
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 1.0
    Moisture Index - lowest period (Bio30) 0.75
    Moisture Index - lowest quarter mean (Bio33) 0.85
    Moisture Index - seasonality (Bio31) 8.0
    Moisture Index - warmest quarter mean (Bio34) 0.89
    Nitrogen - plant-available pre-European 6969.378 kgN/ha
    Nitrogen concentration pre-European 37.77365 mgN kg/H2O
    Nitrogen store pre-European 108.4575 kgN/ha
    Nutrient status 0.95 index
    Pedality hydrological score 2.1
    Phosphorus - plant-available pre-European 19.77975 kgP/ha
    Phosphorus - plant-available total pre-European 1159.498 kgP/ha
    Phosphorus pre-European 6.888906 mgP kg/H2O
    Soil depth 0.85999995 m
    Soil pedality 2.1
    Soils - coarse 0.0 class
    Substrate data reliability 2.0
    Topographic wetness index 4.815811
    Unreliable water retention parameters 0.0
    Water deficit - month max 0.0 mm
    Water deficit - month mean 0.0 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 84000.0 mm
    Water holding capacity - plant-available 149.0 mm
    Water potential - annual mean -0.061774276 MPa
    Water potential - month max -2.8643754E-14 MPa
    Water potential - month min -0.3475746 MPa
    Water stress index - annual mean 80.99999
    Water stress index - month max 81.0
    Water stress index - month min 80.99999
    Water surplus - annual mean 55.74656 mm
    Water surplus - month max 144.0 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 3.57423 Weathering Intensity Index
    Topography
    Averaged Topographic Relief 32.333332 metres
    Bathymetry and Topography 9 sec 0.0 m
    Ridge top flatness 0.9405358
    Ridge top flatness - proportion 0.0 %
    Topographic Slope (degrees) 0.0 degrees
    Topographic relief 7.331223 m
    Topographic roughness 93.658 %
    Topographic slope (%) 0.4138207 %
    Valley bottom % 12.5 %
    Valley bottom flatness index 2.9396
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.1631 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 6.0 %
    Gross Primary Productivity (2012-03-13) 0.004 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.1 m^2 plant / m^2 ground
    Normalized Difference Vegetation Index (2012-03-05) 0.3306 NDVI
    Phenology peak day of year 2002 dry 152.2258 Day
    Phenology peak day of year 2012 wet 84.09677 Day