Occurrence record: BOLD - Australian records - 3996673

Material Sample of LEPIDOPTERA | Butterflies recorded on 2010-12-24
   API

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3996673
Other catalog numbers ["recordID:1879079;ProcessID:NSWHM2169-11;sampleID:BIOUG00961-G08"]
Record type Material Sample
Supplied basis "MaterialSample"
Collector Hebert, Paul  
Supplied as "Paul Hebert"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Presence/Absence PRESENT

Event

Field Number BIOUG00961-G08
Occurrence date 2010-12-24
Date precision DAY

Taxonomy

Scientific name LEPIDOPTERA
Identified to rank order
Common name Butterflies
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Name match metric exactMatch
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory New South Wales
Latitude -32.377
Supplied as: "-32.377"
Longitude 152.504
Supplied as: "152.504"
Datum EPSG:4326
Coordinate precision Unknown
Georeference protocol Google Earth
Terrestrial true
Biome TERRESTRIAL
Marine false
Country Code AU

Additional properties

genbank accession JN306786
markercode COI-5P
nucleotides TACATTATATTTTATTTTNGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGATTACTAATTCGAGCAGAATTAGGTACCCCTGGATCTTTAATTGGTGATGATCAAATTTATAATACAATTGTCACAGCTCATGCATTTATTATAATTTTTTTCATAGTAATACCAATTATAATTGGAGGATTTGGAAACTGATTAGTACCACTAATACTAGGAGCCCCTGATATAGCATTCCCACGAATAAATAATATAAGATTTTGACTTTTACCACCTTCATTAACATTATTAATTTCTAGAAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCCTTATCCTCTAATATTGCCCATAGAGGAAGCTCTGTTGATTTAGCAATCTTTTCCCTTCATTTAGCCGGAATTTCATCTATTATAGGAGCAGTTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCACTATTTGTTTGAGCAGTAGGAATTACAGCTTTTTTATTATTACTATCTTTACCAGTATTAGCTGGAGCAATTACTATATTACTAACTGATCGTAATTTAAATACATCATTTTTCGACCCTGCTGGAGGAGGAGACCCTATTTTATATCAACACTTATTT
Owner institution code Biodiversity Institute of Ontario
sequence last updated 2011-11-14T08:11:47Z

User flagged issues 

    Data quality tests

    Test name Result
    Coordinate uncertainty meters invalid Warning
    Geodetic datum assumed WGS84 Warning
    Name not supplied Warning
    Show/Hide 75 passed properties
    Show/Hide 6 missing properties
    Show/Hide 30 tests that have not been run

    Additional political boundaries information

    Area Management
    Hunter Analysis Mask GER Hunter Analysis Mask
    NRM Regions 2010 Hunter-Central Rivers
    NRM Regions 2017 Hunter
    Area management
    National Landcare Program Management Units 2018 Hunter
    Biodiversity
    IBRA 6 Regions NSW North Coast
    IBRA 7 Regions NSW North Coast
    IBRA 7 Subregions Karuah Manning
    Hydrology
    Drainage Divisions Level 1 South East Coast (NSW)
    Drainage Divisions Level 2 KARUAH RIVER
    Marine
    States including coastal waters New South Wales (including Coastal Waters)
    Political
    ASGS Australian States and Territories New South Wales
    Australian States and Territories New South Wales
    Local Government Areas 2011 Great Lakes (A)
    Local Government Areas 2012 deprecated Great Lakes
    Local Government Areas PSMA 2018 MID-COAST COUNCIL
    NSW Local Land Services Regions Hunter
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 20
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 1861
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF NSW
    PSMA ABS SA2 Statistical Areas (2016) FORSTER-TUNCURRY REGION
    PSMA ABS SA3 Statistical Areas (2016) GREAT LAKES
    PSMA ABS SA4 Statistical Areas (2016) MID NORTH COAST
    PSMA Commonwealth Electoral Boundaries (2018) LYNE
    PSMA Indigenous Areas (2016) GREAT LAKES
    PSMA Indigenous Locations (2016) BULAHDELAH
    PSMA Indigenous Regions (2016) NSW CENTRAL AND NORTH COAST
    PSMA Remoteness Areas (2016) Inner Regional Australia
    PSMA State Electoral Boundaries (2018) LEGISLATIVE COUNCIL
    PSMA States (2016) NEW SOUTH WALES
    World Country Boundaries Australia
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Forests of Australia 2018B Non forest
    NVIS 4.1 Major Vegetation Groups Eucalypt Tall Open Forests
    NVIS 4.1 Major Vegetation Subgroups Eucalyptus tall open forest with a fine-leaved shrubby understorey
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation types - native Eucalypt tall open forests
    Vegetation types - present Eucalyptus tall open forest

    Environmental sampling for this location

    Climate
    Precipitation - annual (Bio12) 1316.0 mm
    Precipitation - coldest quarter (Bio19) 298.0 mm
    Precipitation - driest period (Bio14) 16.0 mm
    Precipitation - driest quarter (Bio17) 233.0 mm
    Precipitation - seasonality (Bio15) 26.0 mm
    Precipitation - warmest quarter (Bio18) 336.0 mm
    Precipitation - wettest period (Bio13) 38.0 mm
    Precipitation - wettest quarter (Bio16) 439.0 mm
    Radiation - annual mean (Bio20) 16.7 MJ/m2/day
    Radiation - seasonality (Bio23) 33.0
    Radiation - warmest quarter (Bio26) 22.0 MJ/m2/day
    Temperature - annual mean (Bio01) 18.0 degrees C
    Temperature - annual range (Bio07) 18.7 degrees C
    Temperature - coldest period min (Bio06) 7.9 degrees C
    Temperature - coldest quarter mean (Bio11) 13.4 degrees C
    Temperature - diurnal range mean (Bio02) 8.9 degrees C
    Temperature - driest quarter mean (Bio09) 15.7 degrees C
    Temperature - isothermality (Bio03) 0.47 %
    Temperature - seasonality (Bio04) 1.19
    Temperature - warmest period max (Bio05) 26.6 degrees C
    Temperature - warmest quarter (Bio10) 22.3 degrees C
    Temperature - wettest quarter mean (Bio08) 19.0 degrees C
    WorldClim 2.1: Temperature - annual mean 18.029167 °C
    WorldClim: Temperature - isothermality 49.0 %
    Substrate
    Moisture Index - annual mean (Bio28) 0.83
    Moisture Index - highest quarter mean (Bio32) 1.0
    Elevation 104.0 m