Occurrence record: BOLD - Australian records - 3386374

GenomicDNA of PERCIFORMES | Perches recorded on 2002-08-19

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3386374
Other catalog numbers recordID:685605;ProcessID:GOBY098-07;sampleID:HKL-G97
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
Collector/Observer Larson, H.
Supplied as "H. Larson"
License CC-BY-Int
Field number HKL-G97
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Helen K. Larson

Event

Field number HKL-G97
Record date 2002-08-19
Date precision Day

Taxonomy

Scientific name PERCIFORMES
Taxon rank order
Common name Perches
Kingdom Animalia
Phylum Chordata
Class Actinopterygii
Order Perciformes
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province Northern Territory
Locality Wickham Point, Darwin

Additional properties

genbank accession HM422481
markercode COI-5P
nucleotides CCTCTACCTAGTGTTTGGTGCCTGAGCTGGAATAGTAGGCACAGCCCTCAGTCTACTAATTCGAGCTGAACTAAGTCAACCTGGGGCCCTCCTGGGTGATGATCAAATTTATAATGTAATTGTTACAGCCCATGCATTTGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGCAACTGATTAGTTCCCCTAATAATTGGTGCCCCCGACATAGCCTTCCCTCGAATGAATAACATAAGCTTCTGACTCCTCCCCCCTTCTTTCCTTCTTCTCCTTGCTTCTTCTGGCGTTGAAGCAGGGGCCGGGACAGGTTGAACAGTTTATCCTCCTCTGGCAGGGAACCTTGCACATGCTGGAGCTTCTGTAGACCTAACCATTTTCTCACTGCACCTTGCAGGAATTTCATCAATTCTAGGAGCAATTAACTTCATTACCACCATCTTAAATATGAAACCCCCTGCAATTTCACAATATCAAACCCCTCTTTTTGTGTGAGCTGTTCTCATTACAGCAGTTCTTCTTCTTCTCTCCCTTCCAGTTCTAGCTGCTGGCATCACCATACTTCTCACAGACCGAAACCTAAATACCACCTTCTTTGACCCAGCAGGTGGAGGAGATCCGATCTTATACCAAC-----
Owner institution code Museum and Art Gallery of the Northern Territory
sequence last updated 2011-11-14T08:11:17Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 56 tests that have not been run