Occurrence record: BOLD - Australian records - 3996612

GenomicDNA of LEPIDOPTERA | Moths recorded on 2010-12-24

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3996612
Other catalogue numbers recordID:1879016;ProcessID:NSWHM2106-11;sampleID:BIOUG00961-B05
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Hebert, P. Paul
Supplied as "Paul Hebert"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Field number BIOUG00961-B05
Occurrence status present
Abcd identification qualifier Not provided

Event

Field number BIOUG00961-B05
Record date 2010-12-24
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory New South Wales
Local government area Great Lakes (A)
Latitude -32.377
Longitude 152.504
Geodetic datum EPSG:4326
Coordinate precision Unknown
Georeference protocol Google Earth
Biome Terrestrial

Additional properties

genbank accession JN306725
markercode COI-5P
nucleotides AACATTATATTTTATTTTTGGAATTTGAGCCGGAATAGTAGGAACTTCCCTAAGATTATTAATTCGAGCAGAATTAGGAAACCCCGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCACATGCTTTCATTATAATTTTTTTTATGGTTATACCTATCATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATGTTAGGTGCCCCAGATATAGCCTTCCCCCGAATAAATAATATAAGTTTTTGACTTTTACCACCCTCTTTAATTTTATTAATTTCCAGAAGAATTGTAGAAACTGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAACATTGCCCATGGAGGCAGTTCAGTCGATTTAGCTATTTTCTCCCTTCATTTAGCTGGAATCTCGTCAATTTTAGGGGCTATTAATTTTATCACAACAATTATTAATATACGACTAAATAACATATCATTTGATCAAATACCATTATTTGTATGAGCAGTTGGAATTACAGCATTTTTACTATTATTATCCCTACCTGTATTAGCTGGAGCAATTACTATGCTTTTAACAGATCGAAATTTAAATACCTCTTTTTTCGACCCAGCAGGAGGGGGAGATCCAATTCTCTATCAACATTTATTT
owner institution code Biodiversity Institute of Ontario
sequence last updated 2011-11-14T08:11:47Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Missing georeferenced protocol Passed
    Coordinates dont match supplied state Passed
    Show/Hide 12 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Irrigation practice - dominant No irrigation
    Land use Rural residential
    NRM Regions 2010 Hunter-Central Rivers
    NRM Regions 2014 Hunter
    NRM Regions 2015 Hunter
    NRM Regions 2017 Hunter
    NRM Regions 2017 (Qld 2019) Hunter
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Hunter
    Biodiversity
    Freshwater Ecoregions of the World Eastern Coastal Australia
    IBRA 6 Regions NSW North Coast
    IBRA 6 Sub Regions Karuah Manning
    IBRA 7 Regions NSW North Coast
    IBRA 7 Subregions Karuah Manning
    Terrestrial Ecoregional Boundaries Eastern Australian Temperate Forests
    Climate
    Agroclimatic classification of Australia Warmer and wetter end of the warm, wet sub-tropical climates
    Koppen Climate Classification (All Classes) Subtropical: no dry season
    Koppen Climate Classification (Major Classes) Subtropical
    Fire
    Fire regime niches Eucalypt forest (temperate)
    Hydrology
    Drainage Divisions Level 1 South East Coast (NSW)
    Drainage Divisions Level 2 KARUAH RIVER
    River Regions KARUAH RIVER
    Marine
    Marine Ecoregions of the World Manning-Hawkesbury
    States including coastal waters New South Wales (including Coastal Waters)
    Political
    ASGS Australian States and Territories New South Wales
    Australian States and Territories New South Wales
    Commonwealth Electoral Boundaries Paterson
    Local Government Areas 2011 Great Lakes (A)
    Local Government Areas 2012 deprecated Great Lakes
    Local Government Areas PSMA 2018 MID-COAST COUNCIL
    NSW Local Land Services Regions Hunter
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 20
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 1861
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF NSW
    PSMA ABS SA2 Statistical Areas (2016) FORSTER-TUNCURRY REGION
    PSMA ABS SA3 Statistical Areas (2016) GREAT LAKES
    PSMA ABS SA4 Statistical Areas (2016) MID NORTH COAST
    PSMA Commonwealth Electoral Boundaries (2016) LYNE
    PSMA Commonwealth Electoral Boundaries (2018) LYNE
    PSMA Indigenous Areas (2016) GREAT LAKES
    PSMA Indigenous Locations (2016) BULAHDELAH
    PSMA Indigenous Regions (2016) NSW CENTRAL AND NORTH COAST
    PSMA Localities (2018) SMITHS LAKE
    PSMA Remoteness Areas (2016) Inner Regional Australia
    PSMA Section of State (2016) OTHER URBAN
    PSMA Section of State Range (2016) 1,000 TO 4,999
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (NSW)
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) LEGISLATIVE COUNCIL
    PSMA States (2016) NEW SOUTH WALES
    PSMA Urban Centre and Locality (2016) SMITHS LAKE
    Statistical Local Areas Great Lakes (A)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia New England Region
    Surface Geology of Australia Csyb
    Topography
    Physiographic Provinces of Australia New England-Moreton Uplands Province
    Physiographic Regions 2011 Macleay-Barrington Fall
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Native forests and woodlands
    NVIS 4.1 Major Vegetation Groups Eucalypt Tall Open Forests
    NVIS 4.1 Major Vegetation Subgroups Eucalyptus tall open forest with a fine-leaved shrubby understorey
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Residual
    Vegetation types - native Eucalypt tall open forests
    Vegetation types - present Eucalyptus tall open forest

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 8673855.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.6836
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 4.0121
    Endemism 0.010713
    Endemism (Non-marine) 0.011452421
    Mammals – Fritz et al 2009 - 0.5 degree 0.3794
    Migratory species (2008) 18.0 frequency
    Occurrence Density 16573.0 frequency
    Shannon Diversity (H) 6.186062 index
    Species Richness 1691.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 8.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.985835
    2030A1BMk35M: Evaporation - month min 61.22 mm
    2030A1BMk35M: Precipitation - annual mean 102.51833 mm
    2030A1BMk35M: Precipitation - driest month 55.07 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.57731426
    2030A1BMk35M: Precipitation - spring or autumn season -0.7291853
    2030A1BMk35M: Temperature - annual max mean 23.725834 degrees C
    2030A1BMk35M: Temperature - annual min mean 14.684999 degrees C
    2030A1BMk35M: Temperature - annual range 18.779999 degrees C
    Aridity index - annual mean 1.0570186
    Aridity index - month max 2.3502522
    Aridity index - month min 0.4625727
    Evaporation - annual mean 126.84682 (ml/5km x 5km pixel)
    Evaporation - average 25059.0 ml
    Evaporation - month max 202.79343 mm
    Evaporation - month min 65.3741 mm
    Evaporation - variability 10.0 %
    Growth index C3 macrotherm plants - annual mean 0.22 index
    Growth index C3 mesotherm plants - annual mean 0.62 index
    Growth index C4 megatherm plants - annual mean 0.16 index
    Humidity - annual mean relative 83.322235 %
    Humidity - annual mean relative 3pm 78.09815 %
    Humidity - month max relative 87.206795 %
    Humidity - month max relative 3pm 82.194984 %
    Humidity - month min relative 73.67437 %
    Humidity - month min relative 3pm 73.67437 %
    Precipitation - annual 1320.0 mm
    Precipitation - annual (Bio12) 1316.0 mm
    Precipitation - annual mean 114.70136 mm
    Precipitation - annual seasonality -0.052686874
    Precipitation - coldest quarter (Bio19) 298.0 mm
    Precipitation - driest month 79.64562 mm
    Precipitation - driest period (Bio14) 16.0 mm
    Precipitation - driest quarter (Bio17) 233.0 mm
    Precipitation - equinox seasonality ratio 0.57829803
    Precipitation - seasonality (Bio15) 26.0 mm
    Precipitation - spring or autumn season -0.7263104
    Precipitation - warmest quarter (Bio18) 336.0 mm
    Precipitation - wettest month 153.64561 mm
    Precipitation - wettest period (Bio13) 38.0 mm
    Precipitation - wettest quarter (Bio16) 439.0 mm
    Radiation - annual mean (Bio20) 16.7 MJ/m2/day
    Radiation - seasonality (Bio23) 33.0
    Radiation - warmest quarter (Bio26) 22.0 MJ/m2/day
    Temperature - annual max mean 22.0275 degrees C
    Temperature - annual mean (Bio01) 18.0 degrees C
    Temperature - annual min mean 11.219167 degrees C
    Temperature - annual range 20.03543 degrees C
    Temperature - annual range (Bio07) 18.7 degrees C
    Temperature - coldest month min 5.18 degrees C
    Temperature - coldest period min (Bio06) 7.9 degrees C
    Temperature - coldest quarter mean (Bio11) 13.4 degrees C
    Temperature - diurnal range mean (Bio02) 8.9 degrees C
    Temperature - driest quarter mean (Bio09) 15.7 degrees C
    Temperature - isothermality (Bio03) 0.47 %
    Temperature - month hottest maximum 26.03 degrees C
    Temperature - seasonality (Bio04) 1.19
    Temperature - warmest month min 16.92 degrees C
    Temperature - warmest period max (Bio05) 26.6 degrees C
    Temperature - warmest quarter (Bio10) 22.3 degrees C
    Temperature - wettest quarter mean (Bio08) 19.0 degrees C
    Wind run - annual mean 283.4132 km/day
    WorldClim: Precipitation - annual 1370.0 mm
    WorldClim: Precipitation - coldest quarter 322.0 mm
    WorldClim: Precipitation - driest month 70.0 mm
    WorldClim: Precipitation - driest quarter 237.0 mm
    WorldClim: Precipitation - seasonality 29.0
    WorldClim: Precipitation - warmest quarter 436.0 mm
    WorldClim: Precipitation - wettest month 176.0 mm
    WorldClim: Precipitation - wettest quarter 451.0 mm
    WorldClim: Temperature - annual mean 178.0 degrees C * 10
    WorldClim: Temperature - annual range 191.0 degrees C * 10
    WorldClim: Temperature - coldest month min 72.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 130.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 95.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 136.0 degrees C * 10
    WorldClim: Temperature - isothermality 49.0 %
    WorldClim: Temperature - seasonality 3512.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 263.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 219.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 185.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.02236068 km x 100
    Distance - to non-permanent water (weighted) 0.28460497 degrees
    Distance - to permanent water (weighted) 0.0 km
    Euclidean Distance to Coast (metres) 1145.1732 m
    Remoteness index 2.4366574
    Hydrology
    Drainage - average 2770.0 megalitres/5x5km/year
    Drainage - variability 63.0 %
    Runoff - average 6208.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 9.7 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 81.0
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 59.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.6 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 20.0 %
    Bulk density 1.5616667 Mg/m^3
    Carbon - organic 1.2688013 %
    Clay % 42.666668 %
    Hydrologic conductivity - average saturated 40.0 mm/h
    Moisture Index - annual mean (Bio28) 0.83
    Moisture Index - highest quarter mean (Bio32) 1.0
    Nutrient status 1.6 index
    Ph - soil 4.0 ph
    Soil depth 0.9 m
    Soil pedality 3.2
    Water holding capacity 41000.0 mm
    Water stress index - month max 81.0
    Weathering Intensity V2 3.88412 Weathering Intensity Index
    Topography
    Aspect 117.0 degrees
    Averaged Topographic Relief 211.125 metres
    Bathymetry and Topography 9 sec 60.0 m
    Elevation 104.0 m
    Topographic Slope (degrees) 3.3896232 degrees
    Topographic relief 40.33811 m
    Topographic slope (%) 3.100408 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.4092 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 85.0 %
    Fractional Cover - Bare Soil (2012-03-05) 0.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 20.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 80.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0682 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 4.1 m^2 plant / m^2 ground
    NDVI Mean 88.0 NDVI x 100
    NPP Mean 16.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.7532 NDVI