Occurrence record: BOLD - Australian records - 2727870

GenomicDNA of Urolophus kapalensis | Kapala Stingaree recorded on 1986-02-10

Dataset

Data partner	Barcode of Life
Data resource	BOLD - Australian records
Catalog number	2727870
Other catalog numbers	recordID:193790;ProcessID:FOAD360-05;sampleID:BW-1920
Basis of record	GenomicDNA Supplied basis "Genomic DNA"
Preparations	nullnull
Collector	K Graham (NSW Fisheries)
Associated Occurrence Status	Associated record
Associated occurrences	The occurrence is associated with a representative record. For more information see Inferred associated occurrence details
License	CC-BY-Int
Field number	GT 25v
Occurrence remarks
Occurrence status	present
Abcd identification qualifier	Not provided
Identification ID	William White

Event

Field number	GT 25v
Occurrence date	1986-02-10
Date precision	Day

Taxonomy

Scientific name	Urolophus kapalensis
Taxon rank	species
Common name	Kapala Stingaree
Kingdom	Animalia
Phylum	Chordata
Class	Chondrichthyes
Order	Myliobatiformes Supplied as "Rajiformes"
Family	Urolophidae
Genus	Urolophus
Species	Urolophus kapalensis
Taxonomic issue	No issues
Name match metric	Canonical name match The supplied name was parsed into canonical form before a match was found.
Name parse type	SCIENTIFIC

Geospatial

Country	Australia
State or Territory	New South Wales
Latitude	-33.567
Longitude	151.683
Geodetic datum	EPSG:4326
Coordinate precision	Unknown
Biome	Marine

Additional properties

genbank accession	EU399122
markercode	COI-5P
nucleotides	CCTTTACNTGATCTTTGGTGCATGAGCAGGAATAGTCGGAACTGGCCTTAGCCTTTTAATTCGAACAGAACTTAGTCAGCCCGGTGCCTTACTTGGTGATGATCAAATTTATAATGTAGTCGTCACGGCCCATGCCTTTGTAATAATTTTTTTCATGGTTATACCTATTATAATCGGTGGCTTCGGCAATTGACTCGTTCCCTTAATAATCGGGGCCCCCGACATGGCTTTCCCACGATTAAATAATATAAGCTTTTGACTCCTCCCTCCCTCTTTCCTTCTATTGTTGGCCTCAGCGGGCGTAGAAGCCGGAGCCGGGACCGGATGAACCGTATACCCCCCGCTAGCTGGAAACCTGGCACATGCGGGAGCATCCGTGGACTTAACCATTTTCTCTCTACACTTGGCAGGAATTTCCTCCATCCTTGCATCTATCAACTTTATTACCACTATTATTAATATAAAACCCCCTGCCATCTCCCAATACCAGACCCCCCTCTTCGTGTGGTCTATTCTTATTACCACCATCCTTCTCTTACTATCCCTTCCCGTCTTAGCAGCAGGCATCACCATACTTCTCACAGACCGCAACCTTAACACAACTTTCTTTGACCCCGCAGGAGGGGGGGACCCCATCCTCTATCAACATCTTTTC
Owner institution code	CSIRO, Australian National Fish Collection
sequence last updated	2011-11-14T08:11:25Z

User flagged issues

Data quality tests

Test name	Result
Occurrence status assumed to be present	Warning
Geodetic datum assumed WGS84	Warning
Basis of record not supplied	Passed
Basis of record badly formed	Passed
Invalid collection date	Passed
Incomplete collection date	Passed
First of the month	Passed
Collector name unparseable	Passed
Missing catalogue number	Passed
Data are generalised	Passed
Name not recognised	Passed
Invalid scientific name	Passed
Name not in national checklists	Passed
Decimal coordinates not supplied	Passed
Coordinates are transposed	Passed
Coordinates are out of range for species	Passed
Supplied coordinates are zero	Passed
Zero latitude	Passed
Zero longitude	Passed
Supplied country not recognised	Passed
Location not supplied	Passed
Country inferred from coordinates	Passed
Supplied coordinates centre of state	Passed
Coordinates centre of country	Passed
Missing geodetic datum	Passed
Habitat incorrect for species	Passed
Show/Hide 13 missing properties
Missing an identification qualifier	Missing
Missing name of person who identified the specimen/observation	Missing
Missing identification references	Missing
Missing identification date	Missing
Missing taxonomic rank	Missing
Name not supplied	Missing
Missing coordinate precision	Missing
Coordinate uncertainty not specified	Missing
Missing name of person who georeferenced the occurrence	Missing
Missing georeferenced protocol	Missing
Missing georeferenced sources	Missing
Missing georeferenced verification status	Missing
Missing georeference date	Missing
Show/Hide 47 tests that have not been run
Coordinates dont match supplied state	Unchecked (lack of data)
Higher taxonomy missing	Unchecked (lack of data)
Coordinate precision not valid	Unchecked (lack of data)
Coordinates dont match supplied country	Unchecked (lack of data)
Decimal latitude/longitude conversion failed	Unchecked (lack of data)
unrecognisedOccurrenceStatus	Unchecked (lack of data)
Cultivated / escapee	Unchecked (lack of data)
Coordinate uncertainty not valid	Unchecked (lack of data)
Depth out of range	Unchecked (lack of data)
Unrecognized geodetic datum	Unchecked (lack of data)
Unable to convert UTM coordinates	Unchecked (lack of data)
Media unrepresentative	Unchecked (lack of data)
Kingdom not recognised	Unchecked (lack of data)
Longitude is negated	Unchecked (lack of data)
Coordinates derived from verbatim coordinates	Unchecked (lack of data)
Altitude out of range	Unchecked (lack of data)
Resource taxonomic scope mismatch	Unchecked (lack of data)
Invalid geodetic datum	Unchecked (lack of data)
Badly formed altitude	Unchecked (lack of data)
Day and month transposed	Unchecked (lack of data)
Altitude value non-numeric	Unchecked (lack of data)
Depth value non-numeric	Unchecked (lack of data)
Date precision invalid	Unchecked (lack of data)
First of the year	Unchecked (lack of data)
Depth value supplied in feet	Unchecked (lack of data)
Type status not recognised	Unchecked (lack of data)
Precision / range mismatch	Unchecked (lack of data)
Min and max altitude reversed	Unchecked (lack of data)
Institution code not recognised	Unchecked (lack of data)
Possible duplicate record	Unchecked (lack of data)
Coordinates converted from UTM	Unchecked (lack of data)
Altitude value supplied in feet	Unchecked (lack of data)
Identification date before occurrence date	Unchecked (lack of data)
Min and max depth reversed	Unchecked (lack of data)
Coordinate precision and uncertainty transposed	Unchecked (lack of data)
Collection code not recognised	Unchecked (lack of data)
Homonym issues with supplied name	Unchecked (lack of data)
First of the century	Unchecked (lack of data)
Latitude is negated	Unchecked (lack of data)
Outside expert range for species	Unchecked (lack of data)
Image URL invalid	Unchecked (lack of data)
Unparseable verbatim coordinates	Unchecked (lack of data)
Georeferenced after occurrence date	Unchecked (lack of data)
Coordinates converted to WGS84	Unchecked (lack of data)
No collection date supplied	Unchecked (lack of data)
Latitude Longitude calculated from grid reference	Unchecked (lack of data)
Media unrepresentative for taxon	Unchecked (lack of data)

Inferred associated occurrence details

This record is associated with the representative record. This mean another record has been detected to be similar to this record, and that the other record (the representative record) has the most detailed information for the occurrence. More information about the duplication detection methods and terminology in use is available here:

https://github.com/AtlasOfLivingAustralia/ala-dataquality/wiki/INFERRED_DUPLICATE_RECORD

Representative Record
Record UUID	9b53547a-09e4-4e25-b6c5-adf6fd558cba
Data Resource
Raw Scientific Name	Urolophus kapalensis
Coordinates	-33.5670013427734,151.682998657227
Collector	[K Graham (NSW Fisheries)]
Year	1986
Month	02
Day	10
Related records
Record UUID	9a859139-4b6f-46b2-b481-cbfff04cf0b2
Data Resource	European Molecular Biology Laboratory Australian Mirror
Raw Scientific Name	Urolophus kapalensis
Coordinates	-33.57,151.68
Collector	[K Graham (NSW Fisheries)]
Year	1986
Month	02
Day	10
Comments	Collectors were identical Coordinate precision differs

Record UUID	980dc913-6531-448c-bcb2-29b2c46b9ac8
Data Resource	BOLD - Australian records
Coordinates	-33.567,151.683
Collector	[K Graham (NSW Fisheries)]
Year	1986
Month	02
Day	10
Comments	Collectors were identical Coordinate precision differs

Record UUID	9a859139-4b6f-46b2-b481-cbfff04cf0b2
Data Resource	European Molecular Biology Laboratory Australian Mirror
Raw Scientific Name	Urolophus kapalensis
Coordinates	-33.57,151.68
Collector	[K Graham (NSW Fisheries)]
Year	1986
Month	02
Day	10
Comments	Collectors were identical Coordinate precision differs

Record UUID	980dc913-6531-448c-bcb2-29b2c46b9ac8
Data Resource	BOLD - Australian records
Coordinates	-33.567,151.683
Collector	[K Graham (NSW Fisheries)]
Year	1986
Month	02
Day	10
Comments	Collectors were identical Coordinate precision differs

Additional political boundaries information

Area Management
Australian Coral Ecoregions	South-east Australia
Area management
National Landcare Program Management Units 2018	Marine NRM
Biodiversity
IMCRA 4 Regions	Central Eastern Shelf Province
IMCRA Meso-scale Bioregions	Hawkesbury Shelf
Marine
Contiguous Zone	Contiguous Zone
Continental Shelf	Continental Shelf
Exclusive Economic Zone	Exclusive Economic Zone
FAO Fishery Statistical Areas	81
Geomorphology of the Australian Margin and adjacent seafloor	Shelf
Global Seagrass Species Richness (2003)	5.00000000
Marine Ecoregions of the World	Manning-Hawkesbury

Environmental sampling for this location

Biodiversity
Acacia – Miller et al 2012 - 0.5 degree	0.1175
Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree	0.0
Endemism	0.018501252
Endemism (Non-marine)	0.0
Mammals – Fritz et al 2009 - 0.5 degree	0.2691
Occurrence Density	262.0 frequency
Shannon Diversity (H)	5.050036 index
Species Richness	185.0 frequency
Distance
Euclidean Distance to Coast (metres)	11567.908 m
Marspec Distance to Shore	28.0 km
Hydrology
Water Observations From Space	0.0 Percentage
Marine
GEOMACS - geometric mean	0.004629 Pascals
Marspec Annual Range in Sea Surface Salinity	0.22999999 100 x psu
Marspec Annual Range in Sea Surface Temperature	4.95 100 x degrees C
Marspec Annual Variance in Sea Surface Salinity	0.42999998 100 x psu
Marspec Annual Variance in Sea Surface Temperature	3.2466 10,000 x degrees C
Marspec Bathymetric Slope	0.1 10 x degrees
Marspec Concavity	0.001 1000 x degrees
Marspec East/West Aspect	0.91999996 radians
Marspec Maximum Monthly Sea Surface Salinity	35.63 100 x psu
Marspec Mean Annual Sea Surface Salinity	35.55 100 x psu
Marspec Mean Annual Sea Surface Temperature	20.32 100 x degrees C
Marspec Minimum Monthly Sea Surface Salinity	35.399998 100 x psu
Marspec North/South Aspect	-0.39 1 x radians
Marspec Plan Curvature	1.0E-4 x 10000
Marspec Profile Curvature	0.0 x 10000
Marspec Sea Surface Temperature of the coldest ice-free month	17.76 100 x degrees C
Marspec Sea Surface Temperature of the warmest ice-free month	22.71 100 x degrees C
Sea Surface Temperature - MODIS Terra	20.524569 Degrees C
SeaWIFS K490 Mean	0.0611747 Kd@490nm/m^2
SeaWiFS Chlorophyll Mean	0.37535763 mg/m^3
Topography
Averaged Topographic Relief	22.708334 metres
Bathymetry and Elvation 9 sec	-132.0 m
Topographic Slope (degrees)	0.048150934 degrees

Group	Field Name	Original Value	Processed Value
Classification	Name parse type		SCIENTIFIC
	Species		Urolophus kapalensis
	Name match metric		canonicalMatch
	Vernacular name		Kapala Stingaree
	Scientific name		Urolophus kapalensis
	Class		Chondrichthyes
	Genus id		urn:lsid:biodiversity.org.au:afd.taxon:45c77d03-cc96-4f71-b6b2-087569ba3fab
	Taxon concept ID		urn:lsid:biodiversity.org.au:afd.taxon:efbd9494-436c-4d94-9f4b-bdb0eae8fb14
	Kingdom id		urn:lsid:biodiversity.org.au:afd.taxon:4647863b-760d-4b59-aaa1-502c8cdf8d3c
	Left		184773
	Phylum	Chordata	Chordata
	Kingdom		Animalia
	Class id		urn:lsid:biodiversity.org.au:afd.taxon:6f1093ab-9b44-4a55-9066-7daa2f902093
	Genus	Urolophus	Urolophus
	Phylum id		urn:lsid:biodiversity.org.au:afd.taxon:065f1da4-53cd-40b8-a396-80fa5c74dedd
	Order	Rajiformes	Myliobatiformes
	Taxon rank		species
	Specific epithet	Urolophus kapalensis
	Order id		urn:lsid:biodiversity.org.au:afd.taxon:a4b82b4d-be1e-4de8-99d0-5048054f1fa8
	Species habitats		["Marine"]
	Taxonomic issue		["noIssue"]
	Species id		urn:lsid:biodiversity.org.au:afd.taxon:efbd9494-436c-4d94-9f4b-bdb0eae8fb14
	Family id		urn:lsid:biodiversity.org.au:afd.taxon:5b350f62-1a03-4410-ad07-3a047ca135be
	Family	Urolophidae	Urolophidae
	Taxon rank id		7000
	Right		184773
Event	Date precision		Day
	Event date	1986-02-10	1986-02-10
	Year		1986
	Day		10
	Month		02
Identification	Abcd identification qualifier		Not provided
	Identification qualifier		Not provided
	Identification ID	William White
Occurrence	Basis of record	Genomic DNA	GenomicDNA
	Recorded by	K Graham (NSW Fisheries)	K Graham (NSW Fisheries)
	Modified	2011-11-14T08:11:25Z	2011-11-14
	Field number	GT 25v
	Other catalog numbers	recordID:193790;ProcessID:FOAD360-05;sampleID:BW-1920
	Associated occurrences		9b53547a-09e4-4e25-b6c5-adf6fd558cba
	Occurrence remarks	<![CDATA[(kapalae)]]>
	Occurrence status		present
	Duplication status		D
	Preparations	nullnull
	Catalog number	2727870
Attribution	Data resource		BOLD - Australian records
	Data provider uid		dp35
	License		CC-BY-Int
	Provenance		Published dataset
	Data resource uid	dr375
	Data partner		Barcode of Life
Location	Decimal latitude	-33.567	-33.567
	Country	Australia
	State province	New South Wales
	Decimal longitude	151.683	151.683
	Biome		Marine
	Geodetic datum		EPSG:4326