We have just released new data filter features to improve the way you search and filter data in the ALA. There is now a default data filter in place that excludes lower quality records. You can pre-filter your search results using a suite of other data filters. To learn more, read Getting started with the data profiles.

Occurrence record: BOLD - Australian records - 2727870

GenomicDNA of Urolophus kapalensis | Kapala Stingaree recorded on 1986-02-10

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 2727870
Other catalog numbers recordID:193790;ProcessID:FOAD360-05;sampleID:BW-1920
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
Collector K Graham (NSW Fisheries)
Associated Occurrence Status Associated record
Associated occurrences The occurrence is associated with a representative record.
For more information see Inferred associated occurrence details
License CC-BY-Int
Field number GT 25v
Occurrence remarks
Occurrence status present
Abcd identification qualifier Not provided
Identification ID William White

Event

Field number GT 25v
Occurrence date 1986-02-10
Date precision Day

Taxonomy

Scientific name Urolophus kapalensis
Taxon rank species
Common name Kapala Stingaree
Kingdom Animalia
Phylum Chordata
Class Chondrichthyes
Order Myliobatiformes
Supplied as "Rajiformes"
Family Urolophidae
Genus Urolophus
Species Urolophus kapalensis
Taxonomic issue No issues
Name match metric Canonical name match
The supplied name was parsed into canonical form before a match was found.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory New South Wales
Latitude -33.567
Longitude 151.683
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Marine

Additional properties

genbank accession EU399122
markercode COI-5P
nucleotides CCTTTACNTGATCTTTGGTGCATGAGCAGGAATAGTCGGAACTGGCCTTAGCCTTTTAATTCGAACAGAACTTAGTCAGCCCGGTGCCTTACTTGGTGATGATCAAATTTATAATGTAGTCGTCACGGCCCATGCCTTTGTAATAATTTTTTTCATGGTTATACCTATTATAATCGGTGGCTTCGGCAATTGACTCGTTCCCTTAATAATCGGGGCCCCCGACATGGCTTTCCCACGATTAAATAATATAAGCTTTTGACTCCTCCCTCCCTCTTTCCTTCTATTGTTGGCCTCAGCGGGCGTAGAAGCCGGAGCCGGGACCGGATGAACCGTATACCCCCCGCTAGCTGGAAACCTGGCACATGCGGGAGCATCCGTGGACTTAACCATTTTCTCTCTACACTTGGCAGGAATTTCCTCCATCCTTGCATCTATCAACTTTATTACCACTATTATTAATATAAAACCCCCTGCCATCTCCCAATACCAGACCCCCCTCTTCGTGTGGTCTATTCTTATTACCACCATCCTTCTCTTACTATCCCTTCCCGTCTTAGCAGCAGGCATCACCATACTTCTCACAGACCGCAACCTTAACACAACTTTCTTTGACCCCGCAGGAGGGGGGGACCCCATCCTCTATCAACATCTTTTC
Owner institution code CSIRO, Australian National Fish Collection
sequence last updated 2011-11-14T08:11:25Z

User flagged issues 

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Habitat incorrect for species Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Inferred associated occurrence details

    This record is associated with the representative record. This mean another record has been detected to be similar to this record, and that the other record (the representative record) has the most detailed information for the occurrence. More information about the duplication detection methods and terminology in use is available here:

    Representative Record
    Record UUID 9b53547a-09e4-4e25-b6c5-adf6fd558cba
    Data Resource
    Raw Scientific Name Urolophus kapalensis
    Coordinates -33.5670013427734,151.682998657227
    Collector [K Graham (NSW Fisheries)]
    Year 1986
    Month 02
    Day 10
    Related records
    Record UUID 9a859139-4b6f-46b2-b481-cbfff04cf0b2
    Data Resource European Molecular Biology Laboratory Australian Mirror
    Raw Scientific Name Urolophus kapalensis
    Coordinates -33.57,151.68
    Collector [K Graham (NSW Fisheries)]
    Year 1986
    Month 02
    Day 10
    Comments Collectors were identical
    Coordinate precision differs
    Record UUID 980dc913-6531-448c-bcb2-29b2c46b9ac8
    Data Resource BOLD - Australian records
    Coordinates -33.567,151.683
    Collector [K Graham (NSW Fisheries)]
    Year 1986
    Month 02
    Day 10
    Comments Collectors were identical
    Coordinate precision differs
    Record UUID 9a859139-4b6f-46b2-b481-cbfff04cf0b2
    Data Resource European Molecular Biology Laboratory Australian Mirror
    Raw Scientific Name Urolophus kapalensis
    Coordinates -33.57,151.68
    Collector [K Graham (NSW Fisheries)]
    Year 1986
    Month 02
    Day 10
    Comments Collectors were identical
    Coordinate precision differs
    Record UUID 980dc913-6531-448c-bcb2-29b2c46b9ac8
    Data Resource BOLD - Australian records
    Coordinates -33.567,151.683
    Collector [K Graham (NSW Fisheries)]
    Year 1986
    Month 02
    Day 10
    Comments Collectors were identical
    Coordinate precision differs

    Additional political boundaries information

    Area Management
    Australian Coral Ecoregions South-east Australia
    Area management
    National Landcare Program Management Units 2018 Marine NRM
    Biodiversity
    IMCRA 4 Regions Central Eastern Shelf Province
    IMCRA Meso-scale Bioregions Hawkesbury Shelf
    Marine
    Contiguous Zone Contiguous Zone
    Continental Shelf Continental Shelf
    Exclusive Economic Zone Exclusive Economic Zone
    FAO Fishery Statistical Areas 81
    Geomorphology of the Australian Margin and adjacent seafloor Shelf
    Global Seagrass Species Richness (2003) 5.00000000
    Marine Ecoregions of the World Manning-Hawkesbury

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.1175
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 0.0
    Endemism 0.018501252
    Endemism (Non-marine) 0.0
    Mammals – Fritz et al 2009 - 0.5 degree 0.2691
    Occurrence Density 262.0 frequency
    Shannon Diversity (H) 5.050036 index
    Species Richness 185.0 frequency
    Distance
    Euclidean Distance to Coast (metres) 11567.908 m
    Marspec Distance to Shore 28.0 km
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    GEOMACS - geometric mean 0.004629 Pascals
    Marspec Annual Range in Sea Surface Salinity 0.22999999 100 x psu
    Marspec Annual Range in Sea Surface Temperature 4.95 100 x degrees C
    Marspec Annual Variance in Sea Surface Salinity 0.42999998 100 x psu
    Marspec Annual Variance in Sea Surface Temperature 3.2466 10,000 x degrees C
    Marspec Bathymetric Slope 0.1 10 x degrees
    Marspec Concavity 0.001 1000 x degrees
    Marspec East/West Aspect 0.91999996 radians
    Marspec Maximum Monthly Sea Surface Salinity 35.63 100 x psu
    Marspec Mean Annual Sea Surface Salinity 35.55 100 x psu
    Marspec Mean Annual Sea Surface Temperature 20.32 100 x degrees C
    Marspec Minimum Monthly Sea Surface Salinity 35.399998 100 x psu
    Marspec North/South Aspect -0.39 1 x radians
    Marspec Plan Curvature 1.0E-4 x 10000
    Marspec Profile Curvature 0.0 x 10000
    Marspec Sea Surface Temperature of the coldest ice-free month 17.76 100 x degrees C
    Marspec Sea Surface Temperature of the warmest ice-free month 22.71 100 x degrees C
    Sea Surface Temperature - MODIS Terra 20.524569 Degrees C
    SeaWIFS K490 Mean 0.0611747 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.37535763 mg/m^3
    Topography
    Averaged Topographic Relief 22.708334 metres
    Bathymetry and Elvation 9 sec -132.0 m
    Topographic Slope (degrees) 0.048150934 degrees