Occurrence record:

EnvironmentalDNA of Clathrus ruber recorded on 2013-08-07

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2013-08-07
Date precision Day

Taxonomy

Scientific name Clathrus ruber
Taxon rank species
Kingdom Fungi
Phylum Basidiomycota
Class Agaricomycetes
Order Phallales
Family Phallaceae
Genus Clathrus
Species Clathrus ruber
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Western Australia
Local government area Coorow (S)
Locality Mt Lesueur NP
Latitude -30.0489
Longitude 115.0423
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial
Verbatim elevation 25.0

Additional properties

ammonium nitrogen mg kg 2.0
amplicon ITS1FITS4_fungi
australian soil classification Calcarosols
boron hot cacl2 mg kg 0.26
broad land use Conservation and Natural Environments
clay 4.87
color BRYW
conductivity dsm ds m 0.019
course sand 88.02
depth m 0.0
detailed land use Conservation and Natural Environments - Nature conservation - National park
dtpa copper mg kg 0.36
dtpa iron mg kg 12.47
dtpa manganese mg kg 0.11
dtpa zinc mg kg 0.2
environment Soil
exc aluminium meq 100g 0.161
exc calcium meq 100g 1.5
exc magnesium meq 100g 0.32
exc potassium meq 100g 0.09
exc sodium meq 100g 0.03
fine sand 6.12
general ecological zone Temperate
gravel 0.0
nitrate nitrogen mg kg 1e-10
otu CCGAATGATACGCATTCATCCGTCCACACCTGTGCACTCTGGCGTGAGGGGAGACCCTCCCGCGTCTAATAAAGACGCCTGTCGTACGCATGAGATTGAGAAAAATTGTCATAAAAGACA
otucount 31
organic carbon 0.22
ph level cacl2 cacl2 7.7
ph level h2o h2o 8.7
phosphorus colwell mg kg 1e-10
potassium colwell mg kg 35.0
sample id 102.100.100/8091
sample type Soil
sand 94.15
silt 0.98
slope 0.0
soil moisture 3.86074905131167
sulphur mg kg 3.6
texture 1.5
vegetation type Heathland
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Altitude out of range Passed
    Altitude value non-numeric Passed
    Altitude value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Habitat incorrect for species Passed
    Show/Hide 12 missing properties
    Show/Hide 44 tests that have not been run

    Outlier information  

    This record has been detected as an outlier using the Reverse Jackknife algorithm for the following layers:

    More information on the data quality work being undertaken by the Atlas is available here:

    Additional political boundaries information

    Area Management
    CAPAD 2010 Terrestrial Lesueur
    CAPAD 2012 Terrestrial Lesueur
    CAPAD 2014 Terrestrial Lesueur
    CAPAD 2016 Terrestrial Lesueur
    Fallow practice - dominant (area) Fallow 3-9 months
    Fallow practice - dominant (number) Fallow 3-9 months
    Global 200 priority ecoregions - Terrestrial Southwestern Australia Forests and Scrub
    Irrigation practice - dominant Four practices equal
    Land use Nature conservation
    NRM Regions 2010 Northern Agricultural
    NRM Regions 2014 Northern Agricultural
    NRM Regions 2015 Northern Agricultural
    NRM Regions 2017 Northern Agricultural Region
    NRM Regions 2017 (Qld 2019) Northern Agricultural Region
    Stubble practice - dominant (area) Stubble left intact
    Stubble practice - dominant (number) Stubble left intact
    Tillage practice - dominant (area) No cultivation
    Tillage practice - dominant (number) No cultivation
    Area management
    National Landcare Program Management Units 2018 Northern Agricultural Region
    Biodiversity
    Freshwater Ecoregions of the World Paleo
    IBRA 6 Regions Geraldton Sandplains
    IBRA 6 Sub Regions Leseur Sandplain
    IBRA 7 Regions Geraldton Sandplains
    IBRA 7 Subregions Lesueur Sandplain
    Terrestrial Ecoregional Boundaries Southwest Australia Savanna
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia "Mediterranean" climate, but with drier cooler winters and less growth than Classic "Mediterranean" climate
    Koppen Climate Classification (All Classes) Subtropical: distinctly dry summer
    Koppen Climate Classification (Major Classes) Subtropical
    Fire
    Fire regime niches Unclassified
    Hydrology
    Drainage Divisions Level 1 South West Coast
    Drainage Divisions Level 2 MOORE-HILL RIVERS
    River Regions MOORE-HILL RIVERS
    Land Management
    Western Australian Biodiversity Science Research Priority Regions South-West
    Marine
    Marine Ecoregions of the World Houtman
    States including coastal waters Western Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories Western Australia
    Australian States and Territories Western Australia
    Commonwealth Electoral Boundaries Durack
    Local Government Areas 2011 Coorow (S)
    Local Government Areas 2012 deprecated Coorow
    Local Government Areas PSMA 2018 SHIRE OF COOROW
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 5
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 373
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF WA
    PSMA ABS SA2 Statistical Areas (2016) MORAWA
    PSMA ABS SA3 Statistical Areas (2016) MID WEST
    PSMA ABS SA4 Statistical Areas (2016) WESTERN AUSTRALIA - OUTBACK (SOUTH)
    PSMA Commonwealth Electoral Boundaries (2016) DURACK
    PSMA Commonwealth Electoral Boundaries (2018) DURACK
    PSMA Indigenous Areas (2016) IRWIN - MORAWA
    PSMA Indigenous Locations (2016) IRWIN - MORAWA
    PSMA Indigenous Regions (2016) GERALDTON
    PSMA Localities (2018) GREEN HEAD
    PSMA Remoteness Areas (2016) Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (WA)
    PSMA State Electoral Boundaries (2016) AGRICULTURAL REGION
    PSMA State Electoral Boundaries (2018) MOORE, AG
    PSMA States (2016) WESTERN AUSTRALIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (WA)
    Statistical Local Areas Coorow (S)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Perth Region
    Surface Geology of Australia Qdct
    Topography
    Physiographic Provinces of Australia Western Coastlands Province
    Physiographic Regions 2011 Dandaragan Tablelands
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Native forest
    Forests of Australia (2013) v2.0 Other native forest
    Land cover Native shrublands and heathlands
    NVIS 4.1 Major Vegetation Groups Other Shrublands
    NVIS 4.1 Major Vegetation Subgroups Other shrublands
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve
    Vegetation - condition Residual
    Vegetation types - native Other shrublands
    Vegetation types - present Other shrublands

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 7168296.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 1.0277
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.7241
    Endemism 0.017369134
    Endemism (Non-marine) 0.018186552
    Mammals – Fritz et al 2009 - 0.5 degree 0.2564
    Migratory species (2008) 3.0 frequency
    Occurrence Density 3270.0 frequency
    Shannon Diversity (H) 5.215457 index
    Species Richness 647.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 2.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.44655442
    2030A1BMk35M: Evaporation - month min 76.92 mm
    2030A1BMk35M: Precipitation - annual mean 44.955 mm
    2030A1BMk35M: Precipitation - driest month 7.03 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.7001159
    2030A1BMk35M: Precipitation - spring or autumn season -0.4233287
    2030A1BMk35M: Temperature - annual max mean 26.865 degrees C
    2030A1BMk35M: Temperature - annual min mean 14.335 degrees C
    2030A1BMk35M: Temperature - annual range 23.74002 degrees C
    Aridity index - annual mean 0.5139867
    Aridity index - month max 1.9099549
    Aridity index - month min 0.019936044
    Evaporation - annual mean 194.4114 (ml/5km x 5km pixel)
    Evaporation - average 13859.0 ml
    Evaporation - month max 351.12283 mm
    Evaporation - month min 76.396965 mm
    Evaporation - variability 17.0 %
    Growth index C3 macrotherm plants - annual mean 0.07 index
    Growth index C3 mesotherm plants - annual mean 0.33 index
    Growth index C4 megatherm plants - annual mean 0.05 index
    Humidity - annual mean relative 73.42727 %
    Humidity - annual mean relative 3pm 64.46936 %
    Humidity - month max relative 85.17762 %
    Humidity - month max relative 3pm 73.33877 %
    Humidity - month min relative 56.08819 %
    Humidity - month min relative 3pm 56.08819 %
    Precipitation - annual 596.0 mm
    Precipitation - annual (Bio12) 580.0 mm
    Precipitation - annual mean 51.041954 mm
    Precipitation - annual seasonality -4.904533
    Precipitation - coldest quarter (Bio19) 304.0 mm
    Precipitation - driest month 7.0 mm
    Precipitation - driest period (Bio14) 1.0 mm
    Precipitation - driest quarter (Bio17) 29.0 mm
    Precipitation - equinox seasonality ratio 0.7067669
    Precipitation - seasonality (Bio15) 87.0 mm
    Precipitation - spring or autumn season -0.4105263
    Precipitation - warmest quarter (Bio18) 34.0 mm
    Precipitation - wettest month 147.25172 mm
    Precipitation - wettest period (Bio13) 28.0 mm
    Precipitation - wettest quarter (Bio16) 331.0 mm
    Radiation - annual mean (Bio20) 19.9 MJ/m2/day
    Radiation - seasonality (Bio23) 35.0
    Radiation - warmest quarter (Bio26) 26.2 MJ/m2/day
    Temperature - annual max mean 25.255001 degrees C
    Temperature - annual mean (Bio01) 19.6 degrees C
    Temperature - annual min mean 12.6725 degrees C
    Temperature - annual range 23.696259 degrees C
    Temperature - annual range (Bio07) 24.0 degrees C
    Temperature - coldest month min 8.61 degrees C
    Temperature - coldest period min (Bio06) 9.1 degrees C
    Temperature - coldest quarter mean (Bio11) 14.7 degrees C
    Temperature - diurnal range mean (Bio02) 12.5 degrees C
    Temperature - driest quarter mean (Bio09) 24.3 degrees C
    Temperature - isothermality (Bio03) 0.52 %
    Temperature - month hottest maximum 32.33 degrees C
    Temperature - seasonality (Bio04) 1.39
    Temperature - warmest month min 17.98 degrees C
    Temperature - warmest period max (Bio05) 33.1 degrees C
    Temperature - warmest quarter (Bio10) 24.9 degrees C
    Temperature - wettest quarter mean (Bio08) 15.3 degrees C
    Wind run - annual mean 289.42752 km/day
    WorldClim: Precipitation - annual 543.0 mm
    WorldClim: Precipitation - coldest quarter 309.0 mm
    WorldClim: Precipitation - driest month 4.0 mm
    WorldClim: Precipitation - driest quarter 27.0 mm
    WorldClim: Precipitation - seasonality 85.0
    WorldClim: Precipitation - warmest quarter 31.0 mm
    WorldClim: Precipitation - wettest month 122.0 mm
    WorldClim: Precipitation - wettest quarter 309.0 mm
    WorldClim: Temperature - annual mean 194.0 degrees C * 10
    WorldClim: Temperature - annual range 234.0 degrees C * 10
    WorldClim: Temperature - coldest month min 93.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 147.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 124.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 243.0 degrees C * 10
    WorldClim: Temperature - isothermality 52.0 %
    WorldClim: Temperature - seasonality 3935.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 327.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 248.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 147.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.06 degrees
    Distance - to coast 0.07615773 km x 100
    Distance - to non-permanent water (weighted) 0.06 degrees
    Distance - to permanent water (weighted) 0.24 km
    Euclidean Distance to Coast (metres) 2329.1887 m
    Remoteness index 6.340367
    Hydrology
    Drainage - average 286.0 megalitres/5x5km/year
    Drainage - variability 175.0 %
    Runoff - average 72.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 0.3 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 81.0
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 32.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.37 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 5.0 %
    Bulk density 1.0177966 Mg/m^3
    Carbon - organic 0.3449084 %
    Clay % 7.076271 %
    Hydrologic conductivity - average saturated 166.66667 mm/h
    Moisture Index - annual mean (Bio28) 0.43
    Moisture Index - highest quarter mean (Bio32) 0.98
    Nutrient status 0.9 index
    Ph - soil 5.0 ph
    Soil depth 0.5 m
    Soil pedality 1.261017
    Water holding capacity 22770.0 mm
    Water stress index - month max 80.99999
    Weathering Intensity V2 5.02043 Weathering Intensity Index
    Topography
    Aspect 356.0 degrees
    Averaged Topographic Relief 64.75 metres
    Bathymetry and Elvation 9 sec 50.0 m
    Elevation 39.0 m
    Topographic Slope (degrees) 1.7172674 degrees
    Topographic relief 19.41518 m
    Topographic slope (%) 1.179223 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.2154 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 39.0 %
    Fractional Cover - Bare Soil (2012-03-05) 17.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 44.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 39.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.012 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.9 m^2 plant / m^2 ground
    NDVI Mean 58.0 NDVI x 100
    NPP Mean 8.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.4868 NDVI