Occurrence record: BOLD - Australian records - 3951477

GenomicDNA of LEPIDOPTERA | Moths recorded on 2010-10-08

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3951477
Other catalogue numbers recordID:1819028;ProcessID:PHLCA442-11;sampleID:BIOUG00791-F02
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Carr, C. Christy|Hebert, P. Paul|Kirk, S. Stephanie|Mccormick, J. Jaclyn|Sones, J. Jayme
Supplied as "Christy Carr, Paul Hebert, Stephanie Kirk, Jaclyn McCormick, Jayme Sones"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Field number L#2010AUS-0047
Occurrence status present
Abcd identification qualifier Not provided

Event

Field number L#2010AUS-0047
Record date 2010-10-08
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Australian Capital Territory
Supplied as: "New South Wales"
Local government area Unincorporated ACT
Locality 8 Moss Street
Latitude -35.261
Longitude 149.059
Geodetic datum EPSG:4326
Coordinate precision Unknown
Georeference protocol GPS
Biome Terrestrial

Additional properties

genbank accession JN264280
markercode COI-5P
nucleotides AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATCATTAATTGGAGATGATCAAATCTATAATACAATTGTTACAGCTCACGCCTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGTATAAATAATATAAGATTTTGATTACTTCCACCTTCATTAACTTTATTAATCTCAAGAAGAATCGTAGAAAATGGAGCAGGAACTGGATGAACTGTATACCCCCCTCTTTCTTCTAATATTGCCCATAGAGGAAGATCAGTTGACTTAGCAATTTTTTCCCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTCATCACAACAATTATTAATATACGATTAAATAGTTTAATATTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACTGCTTTTCTTCTTTTACTTTCTTTACCTGTTTTAGCTGGAGCAATTACTATACTTTTAACAGATCGAAATTTAAATACTTCATTTTTCGATCCGGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
owner institution code Biodiversity Institute of Ontario
sequence last updated 2011-11-14T08:11:48Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Coordinates dont match supplied state Failed
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Missing georeferenced protocol Passed
    Show/Hide 12 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    GER Kosciuszko to Coast GER Kosciuszko to Coast
    GER National Corridor GER National Corridor
    GER Standard Boundary GER Standard Boundary
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    Important Bird Areas (IBA) Australia South-west Slopes of NSW IBA
    Irrigation practice - dominant No irrigation
    Land use Modified pastures
    Murray Darling Basin Authority Water Quality Zones Upland
    Murray-Darling Basin Boundary Murray-Darling Basin Boundary
    Murray-Darling Basin Ground Water Plan Areas GW1
    Murray-Darling Basin Ground Water Plan Areas (2018) Australian Capital Territory (groundwater)
    Murray-Darling Basin Ground Water SDL Resource Units Australian Capital Territory (Groundwater) (GS52)
    Murray-Darling Basin Ground Water SDL Resource Units (2018) Australian Capital Territory (Groundwater) (GS52)
    Murray-Darling Basin Surface Water Plan Areas SW1
    Murray-Darling Basin Surface Water Plan Areas (2019) Australian Capital Territory (surface water)
    Murray-Darling Basin Surface Water SDL Resource Units SS1
    Murray-Darling Basin Surface Water SDL Resource Units (2019) Australian Capital Territory (Surface Water)
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Valleys MURRUMBIDGEE
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Zones upland
    NRM Regions 2010 ACT
    NRM Regions 2014 ACT
    NRM Regions 2015 ACT
    NRM Regions 2017 ACT
    NRM Regions 2017 (Qld 2019) ACT
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 ACT
    Biodiversity
    Freshwater Ecoregions of the World Murray - Darling
    IBRA 6 Regions South Eastern Highlands
    IBRA 6 Sub Regions South Eastern Highlands
    IBRA 7 Regions South Eastern Highlands
    IBRA 7 Subregions Murrumbateman
    Terrestrial Ecoregional Boundaries Southeast Australia Temperate Forests
    World Anthropogenic Biomes (2000) Mixed settlements
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Koppen Climate Classification (All Classes) Temperate: no dry season (warm summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Pasture, cropland (temperate)
    Hydrology
    Drainage Divisions Level 1 Murray-Darling Basin
    Drainage Divisions Level 2 DARLING RIVER
    River Regions MURRUMBIDGEE RIVER
    Marine
    Marine Ecoregions of the World Cape Howe
    States including coastal waters Australian Capital Territory
    Political
    ASGS Australian States and Territories Australian Capital Territory
    Australian States and Territories Australian Capital Territory
    Commonwealth Electoral Boundaries Fraser
    Local Government Areas 2011 Unincorporated ACT
    Local Government Areas 2012 deprecated Cook
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water Ngambri, Ngunnawal/Ngunawal, Ngarigu, Wulgalu
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water (2019) Ngambri, Ngunnawal/Ngunawal, Ngarigu, Wolgalu
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water Ngunnawal/Ngunawal, Wulgalu, Ngambri, Ngarigu
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water (2019) Ngunnawal/Ngunawal, Wolgalu, Ngambri, Ngarigu
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 64
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 3162
    PSMA ABS Greater Capital City Statistical Areas (2016) AUSTRALIAN CAPITAL TERRITORY
    PSMA ABS SA2 Statistical Areas (2016) MOLONGLO CORRIDOR
    PSMA ABS SA3 Statistical Areas (2016) BELCONNEN
    PSMA ABS SA4 Statistical Areas (2016) AUSTRALIAN CAPITAL TERRITORY
    PSMA Commonwealth Electoral Boundaries (2016) FENNER
    PSMA Commonwealth Electoral Boundaries (2018) CANBERRA
    PSMA Indigenous Areas (2016) CANBERRA - NORTH
    PSMA Indigenous Locations (2016) BELCONNEN
    PSMA Indigenous Regions (2016) ACT
    PSMA Localities (2018) BELCONNEN
    PSMA Remoteness Areas (2016) Major Cities of Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (ACT)
    PSMA State Electoral Boundaries (2016) GINNINDERRA
    PSMA State Electoral Boundaries (2018) GINNINDERRA
    PSMA States (2016) AUSTRALIAN CAPITAL TERRITORY
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (ACT)
    Statistical Local Areas Belconnen - SSD Bal
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Lachlan Region
    Surface Geology of Australia Sfdw
    Topography
    Physiographic Provinces of Australia Kosciuszkan Uplands Province
    Physiographic Regions 2011 Werriwa Tablelands
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Native grasslands and minimally modified pastures
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve
    Vegetation - condition Transformed
    Vegetation types - native Eucalypt woodlands
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 2094150.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 4.6961
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.381
    Endemism 0.038606327
    Endemism (Non-marine) 0.047146842
    Mammals – Fritz et al 2009 - 0.5 degree 0.6197
    Migratory species (2008) 5.0 frequency
    Occurrence Density 664901.0 frequency
    Shannon Diversity (H) 4.4352946 index
    Species Richness 4353.0 frequency
    Threatened communities (2008) 1.0 frequency
    Threatened species (2008) 9.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.58637774
    2030A1BMk35M: Evaporation - month min 38.38 mm
    2030A1BMk35M: Precipitation - annual mean 52.173332 mm
    2030A1BMk35M: Precipitation - driest month 42.15 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.1551747
    2030A1BMk35M: Precipitation - spring or autumn season 0.15411
    2030A1BMk35M: Temperature - annual max mean 20.845833 degrees C
    2030A1BMk35M: Temperature - annual min mean 8.0725 degrees C
    2030A1BMk35M: Temperature - annual range 27.529999 degrees C
    Aridity index - annual mean 0.6770381
    Aridity index - month max 1.4254955
    Aridity index - month min 0.23858562
    Evaporation - annual mean 121.35428 (ml/5km x 5km pixel)
    Evaporation - average 14724.0 ml
    Evaporation - month max 233.20386 mm
    Evaporation - month min 36.52413 mm
    Evaporation - variability 14.0 %
    Growth index C3 macrotherm plants - annual mean 0.05 index
    Growth index C3 mesotherm plants - annual mean 0.22 index
    Growth index C4 megatherm plants - annual mean 0.04 index
    Humidity - annual mean relative 81.666084 %
    Humidity - annual mean relative 3pm 67.76495 %
    Humidity - month max relative 93.61619 %
    Humidity - month max relative 3pm 79.870384 %
    Humidity - month min relative 56.292667 %
    Humidity - month min relative 3pm 56.292667 %
    Precipitation - annual 701.0 mm
    Precipitation - annual (Bio12) 681.0 mm
    Precipitation - annual mean 58.14888 mm
    Precipitation - annual seasonality 0.13349561
    Precipitation - coldest quarter (Bio19) 161.0 mm
    Precipitation - driest month 49.0 mm
    Precipitation - driest period (Bio14) 10.0 mm
    Precipitation - driest quarter (Bio17) 143.0 mm
    Precipitation - equinox seasonality ratio 1.1562557
    Precipitation - seasonality (Bio15) 14.0 mm
    Precipitation - spring or autumn season 0.15533663
    Precipitation - warmest quarter (Bio18) 171.0 mm
    Precipitation - wettest month 72.0 mm
    Precipitation - wettest period (Bio13) 17.0 mm
    Precipitation - wettest quarter (Bio16) 198.0 mm
    Radiation - annual mean (Bio20) 16.9 MJ/m2/day
    Radiation - seasonality (Bio23) 38.0
    Radiation - warmest quarter (Bio26) 23.9 MJ/m2/day
    Temperature - annual max mean 18.588333 degrees C
    Temperature - annual mean (Bio01) 13.3 degrees C
    Temperature - annual min mean 6.6633334 degrees C
    Temperature - annual range 26.662079 degrees C
    Temperature - annual range (Bio07) 27.7 degrees C
    Temperature - coldest month min 0.72 degrees C
    Temperature - coldest period min (Bio06) 0.5 degrees C
    Temperature - coldest quarter mean (Bio11) 6.6 degrees C
    Temperature - diurnal range mean (Bio02) 12.6 degrees C
    Temperature - driest quarter mean (Bio09) 10.0 degrees C
    Temperature - isothermality (Bio03) 0.45 %
    Temperature - month hottest maximum 26.71 degrees C
    Temperature - seasonality (Bio04) 1.83
    Temperature - warmest month min 12.73 degrees C
    Temperature - warmest period max (Bio05) 28.2 degrees C
    Temperature - warmest quarter (Bio10) 20.0 degrees C
    Temperature - wettest quarter mean (Bio08) 13.1 degrees C
    Wind run - annual mean 151.55699 km/day
    WorldClim: Precipitation - annual 704.0 mm
    WorldClim: Precipitation - coldest quarter 163.0 mm
    WorldClim: Precipitation - driest month 46.0 mm
    WorldClim: Precipitation - driest quarter 153.0 mm
    WorldClim: Precipitation - seasonality 13.0
    WorldClim: Precipitation - warmest quarter 171.0 mm
    WorldClim: Precipitation - wettest month 74.0 mm
    WorldClim: Precipitation - wettest quarter 202.0 mm
    WorldClim: Temperature - annual mean 126.0 degrees C * 10
    WorldClim: Temperature - annual range 284.0 degrees C * 10
    WorldClim: Temperature - coldest month min -5.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 58.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 133.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 92.0 degrees C * 10
    WorldClim: Temperature - isothermality 46.0 %
    WorldClim: Temperature - seasonality 5284.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 279.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 194.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 122.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 1.225602 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.022360679 km
    Euclidean Distance to Coast (metres) 60377.375 m
    Remoteness index 0.0
    Fire
    Fire - time since last 6.0 years
    Fire frequency 1.0 frequency
    Hydrology
    Drainage - average 1184.0 megalitres/5x5km/year
    Drainage - variability 117.0 %
    Runoff - average 300.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Substrate
    2030A1BMk35M: Water stress index - month max 81.0
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 74.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.4 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 15.0 %
    Bulk density 1.5332901 Mg/m^3
    Carbon - organic 1.3007573 %
    Clay % 34.017357 %
    Hydrologic conductivity - average saturated 51.0 mm/h
    Moisture Index - annual mean (Bio28) 0.57
    Moisture Index - highest quarter mean (Bio32) 0.9
    Nutrient status 1.0 index
    Ph - soil 4.0 ph
    Soil depth 1.1 m
    Soil pedality 2.7409327
    Water holding capacity 53000.0 mm
    Water stress index - month max 81.0
    Weathering Intensity V2 3.03196 Weathering Intensity Index
    Topography
    Aspect 25.0 degrees
    Averaged Topographic Relief 181.04167 metres
    Bathymetry and Topography 9 sec 658.0 m
    Elevation 636.0 m
    Topographic Slope (degrees) 1.9789724 degrees
    Topographic relief 54.13074 m
    Topographic slope (%) 3.653375 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3795 EVI
    Fractional Cover - Bare Soil (2012-03-05) 14.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 19.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 68.0 % Persistent Vegetation
    NDVI Mean 53.0 NDVI x 100
    NPP Mean 0.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.6693 NDVI