Occurrence record: BOLD - Australian records - 3978281

GenomicDNA of LEPIDOPTERA | Moths recorded on 2003-05-19

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3978281
Other catalogue numbers recordID:1888722;ProcessID:ANICR1979-11;sampleID:11ANIC-03979
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Zwick, A.
Supplied as "A.Zwick"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Field number 11ANIC-03979
Occurrence status present
Abcd identification qualifier Not provided

Event

Field number 11ANIC-03979
Record date 2003-05-19
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Western Australia
Local government area Ashburton (S)
Locality Fortescue River Basin Gt Northern Hway
Latitude -22.17
Longitude 118.45
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession JN267416
markercode COI-5P
nucleotides AACTCTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGGACTTCATTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGATCATTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAACTGATTAGTTCCTTTAATATTAGGGGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTATTACCTTATTAATCTCTAGTAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACGGTTTACCCCCCTCTCTCATCTAATATTGCTCATGGAGGAAGTTCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCCCTATTTGTTTGAGCTGTAGGAATTACAGCATTTTTATTATTATTATCTTTACCTGTATTAGCTGGAGCTATTACTATACTTCTTACAGATCGAAACTTAAATACATCTTTTTTCGACCCTGCGGGAGGGGGAGACCCCATTTTATATCAACATTTATTT
owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:44Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Directory of Important Wetlands Fortescue Marshes
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Global 200 priority ecoregions - Terrestrial Carnavon Xeric Shrubs
    Irrigation practice - dominant No irrigation
    Land use Grazing of native pastures
    NRM Regions 2010 Rangelands
    NRM Regions 2014 Rangelands
    NRM Regions 2015 Rangelands
    NRM Regions 2017 Rangelands Region
    NRM Regions 2017 (Qld 2019) Rangelands Region
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Rangelands Region
    Biodiversity
    Freshwater Ecoregions of the World Pilbara
    IBRA 6 Regions Pilbara
    IBRA 6 Sub Regions Fortescue
    IBRA 7 Regions Pilbara
    IBRA 7 Subregions Fortescue
    Terrestrial Ecoregional Boundaries Pilbara Shrublands
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Desert, supporting very little plant growth due to water limitation
    Koppen Climate Classification (All Classes) Desert: hot (winter drought)
    Koppen Climate Classification (Major Classes) Grassland
    Fire
    Fire regime niches Acacia shrubland (mulga) (semi-arid/arid)
    Hydrology
    Drainage Divisions Level 1 Pilbara-Gascoyne
    Drainage Divisions Level 2 FORTESCUE RIVER
    River Regions FORTESCUE RIVER
    Land Management
    Western Australian Biodiversity Science Research Priority Regions Pilbara
    Marine
    Marine Ecoregions of the World Exmouth to Broome
    States including coastal waters Western Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories Western Australia
    Australian States and Territories Western Australia
    Commonwealth Electoral Boundaries Durack
    Local Government Areas 2011 Ashburton (S)
    Local Government Areas 2012 deprecated Ashburton
    Local Government Areas PSMA 2018 SHIRE OF ASHBURTON
    National Native Title Register (NNTR, Determinations of Native Title) - boundaries and core attributes Banjima People
    Native Title Determinations (13/7/2020) Banjima People WCD2014/001
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 179
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 1082
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF WA
    PSMA ABS SA2 Statistical Areas (2016) ASHBURTON (WA)
    PSMA ABS SA3 Statistical Areas (2016) WEST PILBARA
    PSMA ABS SA4 Statistical Areas (2016) WESTERN AUSTRALIA - OUTBACK (NORTH)
    PSMA Commonwealth Electoral Boundaries (2016) DURACK
    PSMA Commonwealth Electoral Boundaries (2018) DURACK
    PSMA Indigenous Areas (2016) EXMOUTH - ASHBURTON
    PSMA Indigenous Locations (2016) EXMOUTH - ASHBURTON - SURROUNDS
    PSMA Indigenous Regions (2016) SOUTH HEDLAND
    PSMA Localities (2018) MULGA DOWNS
    PSMA Remoteness Areas (2016) Very Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (WA)
    PSMA State Electoral Boundaries (2016) MINING AND PASTORAL REGION
    PSMA State Electoral Boundaries (2018) MINING AND PASTORAL REGION
    PSMA States (2016) WESTERN AUSTRALIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (WA)
    PSMA Wards (2018) TABLELAND WARD
    Statistical Local Areas Ashburton (S)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Hamersley Region
    Surface Geology of Australia Qa
    Topography
    Physiographic Provinces of Australia Pilbara Province
    Physiographic Regions 2011 Fortescue Valley
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Native grasslands and minimally modified pastures
    NVIS 4.1 Major Vegetation Groups Tussock Grasslands
    NVIS 4.1 Major Vegetation Subgroups Other tussock grasslands
    Tenure of Australia's forests (2013) v2.0 Leasehold
    Vegetation - condition Modified
    Vegetation types - native Tussock grasslands
    Vegetation types - present Tussock grasslands

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 6180020.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 1.0596
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 1.9862
    Endemism 0.0052197957
    Endemism (Non-marine) 0.0052360645
    Mammals – Fritz et al 2009 - 0.5 degree 0.2564
    Migratory species (2008) 3.0 frequency
    Occurrence Density 352.0 frequency
    Shannon Diversity (H) 4.859911 index
    Species Richness 168.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 1.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.11862678
    2030A1BMk35M: Evaporation - month min 130.28 mm
    2030A1BMk35M: Precipitation - annual mean 31.631666 mm
    2030A1BMk35M: Precipitation - driest month 0.0 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.06774333
    2030A1BMk35M: Precipitation - spring or autumn season -11.863448
    2030A1BMk35M: Temperature - annual max mean 35.005833 degrees C
    2030A1BMk35M: Temperature - annual min mean 20.528334 degrees C
    2030A1BMk35M: Temperature - annual range 29.059998 degrees C
    Aridity index - annual mean 0.103097275
    Aridity index - month max 0.26542863
    Aridity index - month min 0.0036873154
    Evaporation - annual mean 279.73572 (ml/5km x 5km pixel)
    Evaporation - average 10047.0 ml
    Evaporation - month max 395.9 mm
    Evaporation - month min 154.6 mm
    Evaporation - variability 41.0 %
    Growth index C3 macrotherm plants - annual mean 0.07 index
    Growth index C3 mesotherm plants - annual mean 0.04 index
    Growth index C4 megatherm plants - annual mean 0.08 index
    Humidity - annual mean relative 52.901684 %
    Humidity - annual mean relative 3pm 43.217014 %
    Humidity - month max relative 64.219696 %
    Humidity - month max relative 3pm 53.45298 %
    Humidity - month min relative 35.49397 %
    Humidity - month min relative 3pm 35.49397 %
    Precipitation - annual 343.0 mm
    Precipitation - annual (Bio12) 418.0 mm
    Precipitation - annual mean 28.916666 mm
    Precipitation - annual seasonality 1.8351648
    Precipitation - coldest quarter (Bio19) 48.0 mm
    Precipitation - driest month 1.0 mm
    Precipitation - driest period (Bio14) 0.0 mm
    Precipitation - driest quarter (Bio17) 8.0 mm
    Precipitation - equinox seasonality ratio 0.10784314
    Precipitation - seasonality (Bio15) 105.0 mm
    Precipitation - spring or autumn season -7.5833335
    Precipitation - warmest quarter (Bio18) 237.0 mm
    Precipitation - wettest month 79.0 mm
    Precipitation - wettest period (Bio13) 31.0 mm
    Precipitation - wettest quarter (Bio16) 269.0 mm
    Radiation - annual mean (Bio20) 22.3 MJ/m2/day
    Radiation - seasonality (Bio23) 22.0
    Radiation - warmest quarter (Bio26) 26.3 MJ/m2/day
    Temperature - annual max mean 32.675 degrees C
    Temperature - annual mean (Bio01) 26.2 degrees C
    Temperature - annual min mean 18.817501 degrees C
    Temperature - annual range 37.5 degrees C
    Temperature - annual range (Bio07) 29.7 degrees C
    Temperature - coldest month min 10.83 degrees C
    Temperature - coldest period min (Bio06) 10.7 degrees C
    Temperature - coldest quarter mean (Bio11) 18.8 degrees C
    Temperature - diurnal range mean (Bio02) 14.3 degrees C
    Temperature - driest quarter mean (Bio09) 26.0 degrees C
    Temperature - isothermality (Bio03) 0.48 %
    Temperature - month hottest maximum 39.45 degrees C
    Temperature - seasonality (Bio04) 1.8
    Temperature - warmest month min 25.14 degrees C
    Temperature - warmest period max (Bio05) 40.3 degrees C
    Temperature - warmest quarter (Bio10) 32.3 degrees C
    Temperature - wettest quarter mean (Bio08) 31.8 degrees C
    Wind run - annual mean 180.39268 km/day
    WorldClim: Precipitation - annual 359.0 mm
    WorldClim: Precipitation - coldest quarter 47.0 mm
    WorldClim: Precipitation - driest month 2.0 mm
    WorldClim: Precipitation - driest quarter 12.0 mm
    WorldClim: Precipitation - seasonality 92.0
    WorldClim: Precipitation - warmest quarter 195.0 mm
    WorldClim: Precipitation - wettest month 86.0 mm
    WorldClim: Precipitation - wettest quarter 220.0 mm
    WorldClim: Temperature - annual mean 263.0 degrees C * 10
    WorldClim: Temperature - annual range 288.0 degrees C * 10
    WorldClim: Temperature - coldest month min 112.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 188.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 137.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 274.0 degrees C * 10
    WorldClim: Temperature - isothermality 47.0 %
    WorldClim: Temperature - seasonality 5425.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 400.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 324.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 318.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 1.677647 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.34828147 km
    Euclidean Distance to Coast (metres) 159087.2 m
    Remoteness index 17.427513
    Fire
    Fire - time since last 9.0 years
    Fire frequency 1.0 frequency
    Hydrology
    Drainage - average 155.0 megalitres/5x5km/year
    Drainage - variability 276.0 %
    Runoff - average 840.0 megalitres/5x5km/year
    Water Observations From Space 8.801956 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 0.1 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 37.44143
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 100.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.54 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 38.0 %
    Bulk density 1.2478261 Mg/m^3
    Carbon - organic 0.2555754 %
    Clay % 33.391304 %
    Hydrologic conductivity - average saturated 40.0 mm/h
    Moisture Index - annual mean (Bio28) 0.12
    Moisture Index - highest quarter mean (Bio32) 0.27
    Nutrient status 1.25 index
    Soil depth 0.6 m
    Soil pedality 2.3594203
    Water holding capacity 34500.0 mm
    Water stress index - month max 23.888575
    Weathering Intensity V2 3.22416 Weathering Intensity Index
    Topography
    Aspect 217.0 degrees
    Averaged Topographic Relief 14.5 metres
    Bathymetry and Elvation 9 sec 396.0 m
    Elevation 398.0 m
    Topographic Slope (degrees) 0.121351324 degrees
    Topographic relief 1.314331 m
    Topographic slope (%) 0.09268657 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.0422 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 12.0 %
    Fractional Cover - Bare Soil (2012-03-05) 5.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 73.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 22.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0046 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.2 m^2 plant / m^2 ground
    NDVI Mean 44.0 NDVI x 100
    NPP Mean 0.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.1495 NDVI