Occurrence record: BOLD - Australian records - 3456095

GenomicDNA of LEPIDOPTERA | Moths recorded on 2005-03-03

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3456095
Other catalogue numbers recordID:1299538;ProcessID:SASNB545-09;sampleID:barcode SNB 1545
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Reproductive condition sexual
Sex male
Life stage adult
License CC-BY-Int
Field number barcode SNB 1545
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Stefan Naumann

Event

Field number barcode SNB 1545
Record date 2005-03-03
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Queensland
Locality Atherton

Additional properties

genbank accession HM416775
markercode COI-5P
nucleotides AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCTTTAAGACTTTTAATTCGAGCTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGGAACTGATTAGTCCCATTAATATTAGGAGCCCCTGACATAGCTTTCCCACGAATAAATAATATAAGTTTTTGACTTCTACCCCCTTCTTTAACTCTTTTAATCTCTAGAAGAATTGTAGAAAATGGAGCCGGAACAGGATGAACAGTTTACCCCCCTCTTTCCTCTAATATTGCTCATGGAGGAACTTCTGTAGACTTAGCTATTTTTTCCCTTCATCTTGCAGGTATTTCATCAATTTTAGGTGCAATTAATTTTATTACAACAATTATTAATATACGAATAAATAATTTATCGTTTGATCAAATACCTTTATTTGTCTGAGCAGTAGGAATTACAGCTTTTCTTCTTCTTTTATCTCTTCCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAACCTTAATACTTCCTTTTTTGACCCTGCTGGAGGAGGAGACCCTATCCTCTATCAACATCTTTTC
owner institution code Research Collection of David Lane
sequence last updated 2011-11-14T08:11:53Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 57 tests that have not been run