Occurrence record: BOLD - Australian records - 3020202

Material Sample of Epinephelus multinotatus (Peters, 1876) | Rankin Cod recorded on 1994-10-31

API

Dataset

Data partner	Barcode of Life
Data resource	BOLD - Australian records
Catalog number	3020202
Other catalog numbers	["recordID:29956;ProcessID:FOA617-04;sampleID:BW-A617"]
Record type	Material Sample Supplied basis "MaterialSample"
Preparations	nullnull
Associated Occurrence Status	Representative record
Associated occurrences	This record has 1 inferred associated occurrences For more information see Inferred associated occurrence details
License	CC-BY-Int
Presence/Absence	PRESENT
Associated records	REPRESENTATIVE
Occurrence remarks

Event

Occurrence date	1994-10-31
Date precision	DAY

Taxonomy

Scientific name	Epinephelus multinotatus
Identified to rank	species
Common name	Rankin Cod
Kingdom	Animalia
Phylum	Chordata
Class	Actinopterygii
Order	Perciformes
Family	Serranidae
Genus	Epinephelus
Species	Epinephelus multinotatus
Name match metric	canonicalMatch
Scientific name authorship	(Peters, 1876)
Name parse type	SCIENTIFIC

Geospatial

Country	Australia
State or Territory	Western Australia
Latitude	-19.5833 Supplied as: "-19.5833"
Longitude	116.667 Supplied as: "116.667"
Datum	EPSG:4326
Coordinate precision	Unknown
Terrestrial	false
Biome	MARINE
Marine	true
Country Code	AU

Additional properties

genbank accession	DQ107888
markercode	COI-5P
nucleotides	CCTTTATCTTGTATTTGGTGCCTGAGCCGGTATAGTAGGAACCGCCCTCAGCCTGCTTATTCGAGCTGAGCTGAGCCAGCCAGGGGCCCTACTTGGCGACGATCAAATCTATAACGTAATTGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGTGGCTTCGGAAACTGACTTGTACCACTTATAGTCGGCGCCCCAGACATGGCATTCCCTCGAATAAACAACATAAGCTTCTGACTTCTTCCCCCATCCTTCCTGCTTCTCCTGGCTTCCTCTGGGGTAGAGGCTGGTGCTGGAACTGGCTGAACGGTCTACCCCCCTCTAGCCGGCAACCTGGCCCACGCAGGAGCATCTGTAGACTTAACCATCTTCTCACTTCACTTAGCGGGGGTCTCATCAATTCTAGGAGCAATTAACTTCATTACAACCATTGTCAATATAAAACCCCCAGCCATCTCGCAGTATCAAACACCTTTATTCGTCTGAGCTGTACTAATCACAGCAGTTCTGCTGCTCTTGTCCCTCCCCGTGCTCGCCGCCGGCATTACAATACTTTTAACAGATCGAAACCTCAACACCACTTTCTTTGACCCAGCCGGAGGGGGAGATCCAATTCTCTACCAGCACTTATTC
Owner institution code	Biodiversity Institute of Ontario
sequence last updated	2011-11-14T08:11:24Z

User flagged issues

Data quality tests

Test name	Result
Coordinate uncertainty meters invalid	Warning
Geodetic datum assumed WGS84	Warning
Name not supplied	Warning
Show/Hide 80 passed properties
Basis of record badly formed	Passed
CONTINENT_COORDINATE_MISMATCH	Passed
Continent country mismatch	Passed
Continent derived from coordinates	Passed
CONTINENT_DERIVED_FROM_COUNTRY	Passed
Continent invalid	Passed
Coordinates centre of country	Passed
Supplied coordinates centre of state	Passed
Coordinate invalid	Passed
Coordinates are out of range for species	Passed
Coordinates converted to WGS84	Passed
Decimal latitude/longitude conversion failed	Passed
Coordinate reprojection suspicious	Passed
Coordinate rounded	Passed
Coordinates dont match supplied country	Passed
Country inferred from coordinates	Passed
Country invalid	Passed
Country mismatch	Passed
First of the century	Passed
First of the month	Passed
First of the year	Passed
Unrecognized geodetic datum	Passed
Georeferenced after occurrence date	Passed
Identification date before occurrence date	Passed
Interpretation error	Passed
Invalid scientific name	Passed
Location not supplied	Passed
Missing collection date	Passed
Modified date invalid	Passed
Modified date unlikely	Passed
Multimedia date invalid	Passed
Multimedia uri invalid	Passed
Occurrence status inferred from basis of record	Passed
Occurrence status inferred from individual count	Passed
Occurrence status unparsable	Passed
Latitude is negated	Passed
Longitude is negated	Passed
Presumed swapped coordinate	Passed
Recorded date invalid	Passed
Recorded date mismatch	Passed
Recorded date unlikely	Passed
SCIENTIFIC_NAME_AND_ID_INCONSISTENT	Passed
Sensitivity report invalid	Passed
Sensitivity report not loadable	Passed
Coordinates dont match supplied state	Passed
Taxon affinity species	Passed
TAXON_CONCEPT_ID_NOT_FOUND	Passed
Taxon confer species	Passed
Taxon default match	Passed
Taxon error	Passed
Taxon excluded	Passed
Taxon excluded associated	Passed
Taxon homonym	Passed
Taxon indeterminate species	Passed
Taxon match aggregate	Passed
Taxon match fuzzy	Passed
Taxon match higher rank	Passed
TAXON_MATCH_NAME_AND_ID_AMBIGUOUS	Passed
Taxon match none	Passed
TAXON_MATCH_TAXON_CONCEPT_ID_IGNORED	Passed
Taxon misapplied	Passed
Taxon misapplied matched	Passed
Taxon parent child synonym	Passed
Taxon question species	Passed
Resource taxonomic scope mismatch	Passed
Taxon species plural	Passed
Coordinate precision and uncertainty transposed	Passed
Uncertainty not specified	Passed
Supplied country not recognised	Passed
Kingdom not recognised	Passed
Supplied coordinates are zero	Passed
Biosecurity issue	Passed
Suspected outlier	Passed
Geospatial issue	Passed
Habitat incorrect for species	Passed
Taxon misidentified	Passed
Taxonomic issue	Passed
Temporal issue	Passed
Other issue	Passed
Duplicate record	Passed
Show/Hide 7 missing properties
Missing geodetic datum	Missing
Missing georeferenced by	Missing
Missing georeference protocol	Missing
Missing georeference sources	Missing
Missing georeference verification status	Missing
Missing georeference date	Missing
Missing taxon rank	Missing
Show/Hide 34 tests that have not been run
Unrecognized collection code	Unchecked (lack of data)
Unrecognized institution code	Unchecked (lack of data)
Coordinate precision invalid	Unchecked (lack of data)
Footprint SRS invalid	Unchecked (lack of data)
Footprint WKT mismatch	Unchecked (lack of data)
Footprint WKT invalid	Unchecked (lack of data)
TAXON_MATCH_SCIENTIFIC_NAME_ID_IGNORED	Unchecked (lack of data)
TAXON_MATCH_TAXON_ID_IGNORED	Unchecked (lack of data)
SCIENTIFIC_NAME_ID_NOT_FOUND	Unchecked (lack of data)
TAXON_ID_NOT_FOUND	Unchecked (lack of data)
Depth value supplied in feet	Unchecked (lack of data)
Depth unlikely	Unchecked (lack of data)
Min and max depth reversed	Unchecked (lack of data)
Depth value non-numeric	Unchecked (lack of data)
Elevation unlikely	Unchecked (lack of data)
Min and max altitude reversed	Unchecked (lack of data)
Altitude value supplied in feet	Unchecked (lack of data)
Altitude value non-numeric	Unchecked (lack of data)
Identified date unlikely	Unchecked (lack of data)
Identified date invalid	Unchecked (lack of data)
Type status invalid	Unchecked (lack of data)
References uri invalid	Unchecked (lack of data)
Individual count invalid	Unchecked (lack of data)
Individual count conflicts with occurrence status	Unchecked (lack of data)
Georeferenced date unlikely	Unchecked (lack of data)
Georeferenced date invalid	Unchecked (lack of data)
Ambiguous institution	Unchecked (lack of data)
Ambiguous collection	Unchecked (lack of data)
Institution not matched	Unchecked (lack of data)
Collection not matched	Unchecked (lack of data)
Institution match fuzzy	Unchecked (lack of data)
Collection match fuzzy	Unchecked (lack of data)
Institution and Collection mismatch	Unchecked (lack of data)
Different owner institution	Unchecked (lack of data)

Inferred associated occurrence details

This record has been identified as the representative occurrence in a group of associated occurrences. This mean other records have been detected that seem to relate to this record and this particular record has the most detailed information on the occurrence. More information about the duplication detection methods and terminology in use is available here:

https://github.com/AtlasOfLivingAustralia/ala-dataquality/wiki/INFERRED_DUPLICATE_RECORD

Representative Record
Record UUID	87a77f8b-786b-412c-8495-c938b58731b8
Data Resource	BOLD - Australian records
Coordinates	-19.5833,116.667
Related records
Record UUID	af94bf1c-56c4-434c-9f05-c3d0e5aa2d61
Data Resource	BOLD - Australian records
Coordinates	-19.5833,116.667

Additional political boundaries information

Area Management
Australian Coral Ecoregions	Ningaloo Reef & NW Western Australia
Area management
National Landcare Program Management Units 2018	Marine NRM
Biodiversity
IMCRA 4 Regions	Northwest Shelf Province
IMCRA Meso-scale Bioregions	Northwest Shelf
Exclusive Economic Zone	Exclusive Economic Zone

Group	Field Name	Original Value	Processed Value
Classification	Scientific name		Epinephelus multinotatus
	Match type		canonicalMatch
	Phylum id		https://biodiversity.org.au/afd/taxa/065f1da4-53cd-40b8-a396-80fa5c74dedd
	Family id		https://biodiversity.org.au/afd/taxa/d4af9632-e2f9-4391-863d-8d95addd8081
	Taxon concept ID		https://biodiversity.org.au/afd/taxa/a7e28f40-20a6-4dd2-bb01-867a911b0a13
	Order	Perciformes	Perciformes
	Taxon rank id		7000
	Species id		https://biodiversity.org.au/afd/taxa/a7e28f40-20a6-4dd2-bb01-867a911b0a13
	Genus	Epinephelus	Epinephelus
	Left		45558
	Scientific name authorship		(Peters, 1876)
	Taxon rank		species
	Genus id		https://biodiversity.org.au/afd/taxa/cc0fa5da-6d2b-43c9-98b1-d55d7047ee9b
	Name type		SCIENTIFIC
	Vernacular name		Rankin Cod
	Order id		https://biodiversity.org.au/afd/taxa/e3fda0ff-4705-4a40-8991-1dfabdadcfae
	Right		45558
	Kingdom		Animalia
	Specific epithet	Epinephelus multinotatus
	Class id		https://biodiversity.org.au/afd/taxa/83e82cc3-be4e-40e8-9e7a-985737c4f726
	Phylum	Chordata	Chordata
	Class		Actinopterygii
	Species		Epinephelus multinotatus
	Family	Serranidae	Serranidae
	Kingdom id		https://biodiversity.org.au/afd/taxa/4647863b-760d-4b59-aaa1-502c8cdf8d3c
Event	Year		1994
	Month		10
	Date precision		DAY
	Day		31
	Event date	1994-10-31	1994-10-31
Occurrence	Associated occurrences		af94bf1c-56c4-434c-9f05-c3d0e5aa2d61
	Duplication status		R
	Type		PhysicalObject
	Catalog number	3020202
	Occurrence status		PRESENT
	Basis of record	MaterialSample	MATERIAL_SAMPLE
	Modified	2011-11-14T08:11:24Z	2011-11-14T08:11:24Z
	Preparations	nullnull
	Duplicate status		REPRESENTATIVE
	Other catalog numbers	[recordID:29956;ProcessID:FOA617-04;sampleID:BW-A617]
	Occurrence remarks	<![CDATA[\|CSIRO unreg (specimen not retained)]]>
Attribution	Data resource		BOLD - Australian records
	License		CC-BY-Int
	Data provider uid		dp35
	Provenance		Published dataset
	Data Resource ID	dr375	dr375
	Data partner		Barcode of Life
Location	Country	Australia	Australia
	Decimal latitude	-19.5833	-19.5833
	Terrestrial	false	false
	Decimal longitude	116.667	116.667
	State province	Western Australia	Western Australia
	Biome		MARINE
	Marine	true	true
	Country code		AU
	Geodetic datum		EPSG:4326