Occurrence record:

EnvironmentalDNA of Fungi recorded on 2017-06-09

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2017-06-09
Date precision Day

Taxonomy

Scientific name Fungi
Taxon rank kingdom
Kingdom Fungi
Phylum Fungi unclassified
Class Fungi unclassified
Order Fungi unclassified
Family Fungi unclassified
Genus Fungi unclassified
Species Fungi unclassified
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type wellformed

Geospatial

Country Australia
State / Province Victoria
Locality Murrindindi (S)
Latitude -37.4901393638889
Longitude 145.586207211111
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

ammonium nitrogen mg kg 28.0
amplicon ITS1FITS4_fungi
boron hot cacl2 mg kg 1.15
clay 22.5680933852148
color GRBR
conductivity dsm ds m 0.125
depth m 0.0
dtpa copper mg kg 0.32
dtpa iron mg kg 117.68
dtpa manganese mg kg 3.17
dtpa zinc mg kg 0.49
environment Soil
exc aluminium meq 100g 4.685
exc calcium meq 100g 2.07
exc magnesium meq 100g 0.41
exc potassium meq 100g 0.48
exc sodium meq 100g 0.05
general ecological zone Montane
gravel 0.0
nitrate nitrogen mg kg 63.0
otu CAAAATGTGACAAAGGGGCTTTAATTAGCCTCCTTTAGTCCTACCCACACCTTGTGAACTGTAGATGTCTCTGGCAGTTTCCAGTTACTGGGAGCTGCCGATGGGTTCTGCCCATCACATCTTTTAACTCTATGCTTCAACTATTACAGTCTGAAAATTCTTCATATTAATAAATGTGAAAA
otucount 2
organic carbon 4.11
ph level cacl2 cacl2 4.3
ph level h2o h2o 4.7
phosphorus colwell mg kg 22.0
potassium colwell mg kg 195.0
sample id 102.100.100/39364
sample type Soil
sand 35.6679636835279
silt 41.7639429312573
soil moisture 47.5
sulphur mg kg 9.3
texture 2.0
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Country inferred from coordinates Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Location not supplied Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 12 missing properties
    Show/Hide 49 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) Fallow 3-9 months
    Fallow practice - dominant (number) Fallow 3-9 months
    GER Central Victorial Biolinks GER Central Victorial Biolinks
    GER National Corridor GER National Corridor
    GER Standard Boundary GER Standard Boundary
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    Irrigation practice - dominant No irrigation
    Land use Forestry
    Murray Darling Basin Authority Water Quality Zones Upland
    Murray-Darling Basin Boundary Murray-Darling Basin Boundary
    Murray-Darling Basin Ground Water Plan Areas GW2
    Murray-Darling Basin Ground Water Plan Areas (2018) Goulburn-Murray
    Murray-Darling Basin Ground Water SDL Resource Units Goulburn-Murray: Shepparton Irrigation Region (GS8)
    Murray-Darling Basin Ground Water SDL Resource Units (2018) Goulburn-Murray: Highlands (GS8b)
    Murray-Darling Basin Surface Water Plan Areas SW3
    Murray-Darling Basin Surface Water Plan Areas (2019) Northern Victoria
    Murray-Darling Basin Surface Water SDL Resource Units SS6
    Murray-Darling Basin Surface Water SDL Resource Units (2019) Goulburn
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Valleys GOULBURN
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Zones upland
    NRM Regions 2010 Goulburn Broken
    NRM Regions 2014 Goulburn Broken
    NRM Regions 2015 Goulburn Broken
    NRM Regions 2017 Goulburn Broken
    NRM Regions 2017 (Qld 2019) Goulburn Broken
    Stubble practice - dominant (area) Stubble mulched
    Stubble practice - dominant (number) Stubble mulched
    Tillage practice - dominant (area) 1-2 = other cultivations
    Tillage practice - dominant (number) 1-2 = other cultivations
    Area management
    National Landcare Program Management Units 2018 Goulburn Broken
    Biodiversity
    Freshwater Ecoregions of the World Murray - Darling
    IBRA 6 Regions South Eastern Highlands
    IBRA 6 Sub Regions Highlands - Northern Fall
    IBRA 7 Regions South Eastern Highlands
    IBRA 7 Subregions Highlands-Northern Fall
    Terrestrial Ecoregional Boundaries Southeast Australia Temperate Forests
    World Anthropogenic Biomes (2000) Wild woodlands
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Koppen Climate Classification (All Classes) Temperate: no dry season (mild summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Eucalypt forest (temperate)
    Hydrology
    Drainage Divisions Level 1 Murray-Darling Basin
    Drainage Divisions Level 2 DARLING RIVER
    River Regions GOULBURN RIVER
    Marine
    Marine Ecoregions of the World Bassian
    States including coastal waters Victoria (including Coastal Waters)
    Political
    ASGS Australian States and Territories Victoria
    Australian States and Territories Victoria
    Commonwealth Electoral Boundaries Indi
    Local Government Areas 2011 Murrindindi (S)
    Local Government Areas 2012 deprecated Murrindindi - East
    Local Government Areas PSMA 2018 MURRINDINDI SHIRE
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water Bangerang, Dhudhuroa, Dja Dja Wurrung, Taungurong, Waywurru, Yaithmathang, Yorta Yorta
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water (2019) Dhudhuroa, Dja Dja Wurrung, Taungurong, Waywurru, Yaithmathang, Yorta Yorta
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water Bangerang, Dja Dja Wurrung, Taungurong, Waywurru, Yorta Yorta
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water (2019) Dhudhuroa, Dja Dja Wurrung, Taungurung, Waywurru, Yorta Yorta
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 4
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 589
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF VIC.
    PSMA ABS SA2 Statistical Areas (2016) ALEXANDRA
    PSMA ABS SA3 Statistical Areas (2016) UPPER GOULBURN VALLEY
    PSMA ABS SA4 Statistical Areas (2016) HUME
    PSMA Commonwealth Electoral Boundaries (2016) INDI
    PSMA Commonwealth Electoral Boundaries (2018) INDI
    PSMA Indigenous Areas (2016) UPPER GOULBURN VALLEY
    PSMA Indigenous Locations (2016) STRATHBOGIE - MANSFIELD - MURIMBINDI
    PSMA Indigenous Regions (2016) VICTORIA EXC. MELBOURNE
    PSMA Localities (2018) NARBETHONG
    PSMA Remoteness Areas (2016) Inner Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (VIC.)
    PSMA State Electoral Boundaries (2016) NORTHERN VICTORIA
    PSMA State Electoral Boundaries (2018) NORTHERN VICTORIA
    PSMA States (2016) VICTORIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (VIC.)
    PSMA Wards (2018) CATHEDRAL WARD
    Statistical Local Areas Murrindindi (S) - East
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Lachlan Region
    Surface Geology of Australia Dg223
    Topography
    Physiographic Provinces of Australia Kosciuszkan Uplands Province
    Physiographic Regions 2011 East Victorian Uplands
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Native forest
    Forests of Australia (2013) v2.0 Eucalypt Tall Open
    Land cover Native forests and woodlands
    NVIS 4.1 Major Vegetation Groups Eucalypt Open Forests
    NVIS 4.1 Major Vegetation Subgroups Eucalyptus (+/- tall) open forest with a dense broad-leaved and/or tree-fern understorey (wet sclerophyll)
    Tenure of Australia's forests (2013) v2.0 Multiple Use Forest
    Vegetation - condition Modified
    Vegetation types - native Eucalypt tall open forests
    Vegetation types - present Eucalyptus tall open forest

    Environmental sampling for this location

    Area Management
    Beef numbers 437881.0 dse
    Dairy numbers 994.0 dse
    Natural resource management expenditure 1.5791342E7 $
    Natural resource management expenditure - additional 0.0 $/ha
    Sheep numbers 39928.0 dse
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.5715
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.1522
    Endemism 0.013623794
    Endemism (Non-marine) 0.015716184
    Mammals – Fritz et al 2009 - 0.5 degree 0.3689
    Migratory species (2008) 5.0 frequency
    Occurrence Density 21512.0 frequency
    Shannon Diversity (H) 5.159144 index
    Species Richness 1291.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 2.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 1.4520966
    2030A1BMk35M: Aridity index - month max 3.5609756
    2030A1BMk35M: Aridity index - month min 0.3320153
    2030A1BMk35M: Evaporation - annual mean 98.472084 mm
    2030A1BMk35M: Evaporation - month max 178.56 mm
    2030A1BMk35M: Evaporation - month min 37.31 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.08 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.39 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.05 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 76.44859 %
    2030A1BMk35M: Humidity - month max relative 3pm 89.07866 %
    2030A1BMk35M: Humidity - month min relative 3pm 63.158054 %
    2030A1BMk35M: Precipitation - annual mean 98.214165 mm
    2030A1BMk35M: Precipitation - driest month 52.06 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.2082231
    2030A1BMk35M: Precipitation - max difference between successive months 1.0506021 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -0.6916842 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 0.58722925
    2030A1BMk35M: Precipitation - spring or autumn season 0.20742832
    2030A1BMk35M: Precipitation - summer or winter season -0.6997721
    2030A1BMk35M: Precipitation - wettest month 132.86 mm
    2030A1BMk35M: Precipitation deficit - annual mean -0.25791708 mm
    2030A1BMk35M: Precipitation deficit - month max -104.740005 mm
    2030A1BMk35M: Precipitation deficit - month min 95.55 mm
    2030A1BMk35M: Radiation - max month precipitation modified 23.16 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 14.470834 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 5.48 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 17.278334 degrees C
    2030A1BMk35M: Temperature - annual min mean 8.151667 degrees C
    2030A1BMk35M: Temperature - annual range 21.169983 degrees C
    2030A1BMk35M: Temperature - coldest month min 4.05 degrees C
    2030A1BMk35M: Temperature - coolest month max 9.49 degrees C
    2030A1BMk35M: Temperature - max difference in max 3.130005 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 1.7900085 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 12.51001 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 9.126666 degrees C
    2030A1BMk35M: Temperature - min difference in max -4.319977 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -2.2600098 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 5.4400024 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 25.22 degrees C
    2030A1BMk35M: Temperature - warmest month min 12.71 degrees C
    Aridity index - annual mean 2.4845183
    Aridity index - month max 6.1254625
    Aridity index - month min 0.46498346
    Evaporation - annual mean 85.948166 (ml/5km x 5km pixel)
    Evaporation - average 19944.0 ml
    Evaporation - month max 172.04913 mm
    Evaporation - month min 23.237175 mm
    Evaporation - variability 3.0 %
    Growth index C3 macrotherm plants - annual mean 0.05 index
    Growth index C3 mesotherm plants - annual mean 0.35 index
    Growth index C4 megatherm plants - annual mean 0.03 index
    Humidity - annual mean relative 86.87505 %
    Humidity - annual mean relative 3pm 75.88772 %
    Humidity - month max relative 94.045715 %
    Humidity - month max relative 3pm 88.550186 %
    Humidity - month min relative 62.422474 %
    Humidity - month min relative 3pm 62.422474 %
    Precipitation - annual 1436.0 mm
    Precipitation - annual (Bio12) 1327.0 mm
    Precipitation - annual (log) seasonality index -0.05517228
    Precipitation - annual mean 124.58385 mm
    Precipitation - annual seasonality -0.42545784
    Precipitation - annual seasonality ratio 0.70118934
    Precipitation - autumn 382.0 mm
    Precipitation - autumn reliability 47.0 %
    Precipitation - coldest quarter (Bio19) 440.0 mm
    Precipitation - driest month 71.81857 mm
    Precipitation - driest period (Bio14) 13.0 mm
    Precipitation - driest quarter (Bio17) 209.0 mm
    Precipitation - equinox seasonality ratio 1.2133386
    Precipitation - max difference between successive months 1.2935219 mm/day
    Precipitation - min difference between successive months -0.98172885 mm/day
    Precipitation - seasonality (Bio15) 28.0 mm
    Precipitation - solstice seasonality ratio 0.5591548
    Precipitation - spring 466.0 mm
    Precipitation - spring or autumn (log) season 0.032987885
    Precipitation - spring or autumn season 0.21272214
    Precipitation - spring reliability 72.0 %
    Precipitation - summer 270.0 mm
    Precipitation - summer or winter (log) season -0.10400883
    Precipitation - summer or winter season -0.7854186
    Precipitation - summer reliability 45.0 %
    Precipitation - warmest quarter (Bio18) 217.0 mm
    Precipitation - wettest month 167.33842 mm
    Precipitation - wettest period (Bio13) 36.0 mm
    Precipitation - wettest quarter (Bio16) 442.0 mm
    Precipitation - winter 558.0 mm
    Precipitation - winter reliability 75.0 %
    Precipitation deficit - annual mean 38.63568 mm
    Precipitation deficit - month max -92.04913 mm
    Precipitation deficit - month min 132.63025 mm
    Radiation - annual mean (Bio20) 14.2 MJ/m2/day
    Radiation - coldest quarter (Bio27) 6.9 MJ/m2/day
    Radiation - driest quarter (Bio25) 20.3 MJ/m2/day
    Radiation - highest period (Bio21) 23.4 MJ/m2/day
    Radiation - lowest period (Bio22) 5.2 MJ/m2/day
    Radiation - max month precipitation modified 23.1 MJ/m2/day
    Radiation - mean annual precipitation modified 13.9130535 MJ/m2/day
    Radiation - min month precipitation modified 5.4 MJ/m2/day
    Radiation - seasonality (Bio23) 47.0
    Radiation - warmest quarter (Bio26) 21.5 MJ/m2/day
    Radiation - wettest quarter (Bio24) 7.2 MJ/m2/day
    Temperature - annual max mean 15.568334 degrees C
    Temperature - annual mean (Bio01) 11.6 degrees C
    Temperature - annual min mean 5.855 degrees C
    Temperature - annual range 21.627655 degrees C
    Temperature - annual range (Bio07) 21.3 degrees C
    Temperature - coldest month min 1.95 degrees C
    Temperature - coldest period min (Bio06) 3.0 degrees C
    Temperature - coldest quarter mean (Bio11) 6.5 degrees C
    Temperature - coolest month max 7.93 degrees C
    Temperature - diurnal range mean (Bio02) 8.8 degrees C
    Temperature - driest quarter mean (Bio09) 16.7 degrees C
    Temperature - isothermality (Bio03) 0.41 %
    Temperature - max absolute mean max 40.0 degrees C
    Temperature - max difference in max 3.1900024 degrees C/day
    Temperature - max difference in min 1.6699829 degrees C/day
    Temperature - max month diurnal range 13.589996 degrees C
    Temperature - mean annual absolute mean min -0.6015666 degrees C
    Temperature - mean annual diurnal range 9.713333 degrees C
    Temperature - min absolute mean min -4.62464 degrees C
    Temperature - min difference in max -4.850006 degrees C/day
    Temperature - min difference in min -2.419983 degrees C/day
    Temperature - min month diurnal range 5.9799805 degrees C
    Temperature - month hottest maximum 23.47 degrees C
    Temperature - month mean absolute max 34.164776 degrees C
    Temperature - seasonality (Bio04) 1.44
    Temperature - warmest month min 10.35 degrees C
    Temperature - warmest period max (Bio05) 24.3 degrees C
    Temperature - warmest quarter (Bio10) 16.9 degrees C
    Temperature - wettest quarter mean (Bio08) 6.5 degrees C
    Vapour pressure deficit - annual mean 0.10775211 KPa
    Vapour pressure deficit - annual mean 9am 0.27731085 KPa
    Vapour pressure deficit - month max 0.5770055 KPa
    Vapour pressure deficit - month max 9am 0.5770055 KPa
    Vapour pressure deficit - month min 0.0 KPa
    Vapour pressure deficit - month min 9am 0.09412944 KPa
    Wind run - annual mean 157.49933 km/day
    Wind run - month max 182.58551 km/day
    Wind run - month min 128.92195 km/day
    Wind speed - annual mean 3pm 3.325 m/s
    Wind speed - annual mean 9am 2.55 m/s
    Wind speed - annual mean 9am or 3pm 3.5 m/s
    Wind speed - month max 3pm 3.8 m/s
    Wind speed - month max 9am 3.2 m/s
    Wind speed - month max 9am or 3pm 3.8 m/s
    Wind speed - month min 3pm 2.8 m/s
    Wind speed - month min 9am 1.9 m/s
    Wind speed - month min 9am or 3pm 1.9 m/s
    WorldClim: Precipitation - annual 1511.0 mm
    WorldClim: Precipitation - coldest quarter 525.0 mm
    WorldClim: Precipitation - driest month 56.0 mm
    WorldClim: Precipitation - driest quarter 204.0 mm
    WorldClim: Precipitation - seasonality 34.0
    WorldClim: Precipitation - warmest quarter 204.0 mm
    WorldClim: Precipitation - wettest month 190.0 mm
    WorldClim: Precipitation - wettest quarter 527.0 mm
    WorldClim: Temperature - annual mean 112.0 degrees C * 10
    WorldClim: Temperature - annual range 228.0 degrees C * 10
    WorldClim: Temperature - coldest month min 18.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 56.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 102.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 168.0 degrees C * 10
    WorldClim: Temperature - isothermality 44.0 %
    WorldClim: Temperature - seasonality 4376.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 246.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 168.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 62.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.7212489 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.08 km
    Euclidean Distance to Coast (metres) 86993.89 m
    Remoteness index 1.7851503
    Hydrology
    Drainage - average 4947.0 megalitres/5x5km/year
    Drainage - variability 27.0 %
    Runoff - average 5148.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Age 47.143 years
    Age - prime group 20.979986 Count
    Disadvantaged 1008.1416 points (mean=1000)
    Education - degrees 11.170445 %
    Education - vocational training 26.065365 %
    Employment 12.386865 %
    Home ownership 70.327446 %
    Income - high 20.707743 %
    Income - low 19.974041 %
    Internet 49.786552 %
    Population - change 8.0671625 count
    Population - density SLA 2006 p/sqkm) 2.7408917 people/km^2
    Unemployment rate 2.8065674 %
    Work force - older 33.00508 Count
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.8348512
    2030A1BMk35M: Crop factor - month max 0.90000004
    2030A1BMk35M: Crop factor - month min 0.52585304
    2030A1BMk35M: Water deficit - month max 7.3790436 mm
    2030A1BMk35M: Water deficit - month mean 0.723423 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -0.39766806 MPa
    2030A1BMk35M: Water potential - month max -2.8643754E-14 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 75.136604
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 47.326775
    2030A1BMk35M: Water surplus - annual mean 16.747065 mm
    2030A1BMk35M: Water surplus - month max 75.961 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 160.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.05 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 55.0 %
    Bouguer gravity anomalies -344.2659 Gal
    Bulk density 1.1338748 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic 4.1329 %
    Carbon store pre-European 417.0806 kgC/ha
    Clay % 41.732483 %
    Crop factor - annual mean 0.8901513
    Crop factor - month max 0.90000004
    Crop factor - month min 0.8344875
    Erodibility 9.0 k factor
    Erosional surfaces - proportion 100.0 %
    Erosivity 2938.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 133.33333 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 26.1 my
    Lithology - fertility 4.0 index
    Lithology - mean age 372.25 my
    Lithology - mean age (log) 2.5708346 log my
    Lithology - mean age range (log) 1.4166405 log my
    Magnetic anomalies -14.0 nT
    Moisture - average 68.0 %
    Moisture - variability 8.0 %
    Moisture Index - annual mean (Bio28) 0.88
    Moisture Index - coldest quarter mean (Bio35) 1.0
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 1.0
    Moisture Index - lowest period (Bio30) 0.4
    Moisture Index - lowest quarter mean (Bio33) 0.57
    Moisture Index - seasonality (Bio31) 22.0
    Moisture Index - warmest quarter mean (Bio34) 0.67
    Nitrogen - plant-available pre-European 34726.89 kgN/ha
    Nitrogen concentration pre-European 90.545 mgN kg/H2O
    Nitrogen store pre-European 308.3184 kgN/ha
    Nutrient status 2.0 index
    Pedality hydrological score 3.6087048
    Ph - soil 4.0 ph
    Phosphorus - plant-available pre-European 56.80682 kgP/ha
    Phosphorus - plant-available total pre-European 4714.196 kgP/ha
    Phosphorus pre-European 16.68267 mgP kg/H2O
    Soil depth 1.2 m
    Soil pedality 3.6087048
    Soils - coarse 0.0 class
    Substrate data reliability 2.0
    Topographic wetness index 6.079774
    Unreliable water retention parameters 0.0
    Water deficit - month max 0.0 mm
    Water deficit - month mean 0.0 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 43000.0 mm
    Water holding capacity - plant-available 196.0 mm
    Water potential - annual mean -0.12723355 MPa
    Water potential - month max -2.8643754E-14 MPa
    Water potential - month min -0.6061609 MPa
    Water stress index - annual mean 80.11362
    Water stress index - month max 81.0
    Water stress index - month min 75.103874
    Water surplus - annual mean 48.25028 mm
    Water surplus - month max 135.30106 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 4.08885 Weathering Intensity Index
    Topography
    Aspect 316.0 degrees
    Averaged Topographic Relief 470.83334 metres
    Bathymetry and Topography 9 sec 604.0 m
    Elevation 667.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Slope length 1000.0 m
    Topographic Slope (degrees) 9.5757675 degrees
    Topographic relief 88.1496 m
    Topographic roughness 3.976967 %
    Topographic slope (%) 7.720212 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 0.0
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.4897 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 90.0 %
    Gross Primary Productivity (2012-03-13) 0.0658 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 6.5 m^2 plant / m^2 ground
    NDVI Mean 88.0 NDVI x 100
    NPP Mean 13.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.8258 NDVI
    Phenology peak day of year 2002 dry 113.44444 Day
    Phenology peak day of year 2012 wet 64.55556 Day