Occurrence record: BOLD - Australian records - 3542789

GenomicDNA of PERCIFORMES | Perches recorded on 2006-05-13

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3542789
Other catalog numbers recordID:1438938;ProcessID:FOAK581-10;sampleID:BW-A8374
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
Collector/Observer K Graham (NSW Fisheries)
License CC-BY-Int
Field number GT 3592
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Ken Graham

Event

Field number GT 3592
Record date 2006-05-13
Date precision Day

Taxonomy

Scientific name PERCIFORMES
Taxon rank order
Common name Perches
Kingdom Animalia
Phylum Chordata
Class Actinopterygii
Order Perciformes
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province New South Wales
Locality E of Broken Bay
Latitude -33.4733
Longitude 151.447
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Marine

Additional properties

genbank accession HM902635
markercode COI-5P
nucleotides CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTGGGCACGGCCTTAAGCCTGCTCATTCGGGCAGAGCTCAGCCAACCAGGCGCTCTCCTAGGAGACGACCAAATTTATAACGTAATTGTTACAGCACACGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTATAATCGGGGGCTTCGGAAACTGGCTTATTCCCCTTATGATCGGCGCCCCAGATATGGCGTTTCCTCGTATAAACAATATGAGCTTTTGACTTCTCCCCCCTTCCTTCCTTCTTCTCCTCGCCTCTTCCGGAGTTGAAGCTGGCGCTGGCACTGGATGAACGGTTTACCCTCCCCTGGCCGGCAATCTAGCCCATGCAGGAGCATCCGTTGATTTAACAATTTTTTCCCTTCACTTAGCAGGTATTTCTTCAATCCTCGGAGCCATTAACTTCATCACAACTATTATTAATATAAAACCCCCGGCCATTTCCCAATACCAAACACCCCTCTTTGTATGGGCTGTCCTAATTACTGCCGTTCTTCTCCTTCTCTCCCTCCCAGTCCTTGCTGCTGGAATCACAATACTTCTTACAGACCGAAACCTCAACACCACTTTCTTTGACCCCGCAGGGGGAGGGGATCCCATCCTCTATCAGCA----
Owner institution code Biodiversity Institute of Ontario
sequence last updated 2011-11-14T08:11:16Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Coral Ecoregions South-east Australia
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Irrigation practice - dominant No irrigation
    NRM Regions 2010 Hunter-Central Rivers
    NRM Regions 2014 Greater Sydney
    NRM Regions 2015 Greater Sydney
    NRM Regions 2017 Greater Sydney
    NRM Regions 2017 (Qld 2019) Greater Sydney
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Greater Sydney
    Biodiversity
    Freshwater Ecoregions of the World Eastern Coastal Australia
    IMCRA 4 Regions Central Eastern Shelf Province
    IMCRA Meso-scale Bioregions Hawkesbury Shelf
    World Anthropogenic Biomes (2000) Urban
    Climate
    Agroclimatic classification of Australia Warmer and wetter end of the warm, wet sub-tropical climates
    Marine
    Geomorphology of the Australian Margin and adjacent seafloor Shelf
    Global Seagrass Species Richness (2003) 5.00000000
    Marine Ecoregions of the World Manning-Hawkesbury
    States including coastal waters New South Wales (including Coastal Waters)
    Territorial Sea Territorial Sea

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.9521
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 5.079
    Endemism 0.015044024
    Endemism (Non-marine) 0.017574735
    Mammals – Fritz et al 2009 - 0.5 degree 0.4792
    Occurrence Density 72821.0 frequency
    Shannon Diversity (H) 6.034652 index
    Species Richness 3447.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.9174448
    2030A1BMk35M: Aridity index - month max 1.8029652
    2030A1BMk35M: Aridity index - month min 0.42058197
    2030A1BMk35M: Evaporation - annual mean 128.1862 mm
    2030A1BMk35M: Evaporation - month max 195.31667 mm
    2030A1BMk35M: Evaporation - month min 63.856667 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.3288889 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.6344444 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.24 index
    2030A1BMk35M: Precipitation - annual mean 103.67676 mm
    2030A1BMk35M: Precipitation - driest month 51.484444 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.55123425
    2030A1BMk35M: Precipitation - max difference between successive months 1.5556271 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -1.7047861 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 1.565232
    2030A1BMk35M: Precipitation - spring or autumn season -0.81052566
    2030A1BMk35M: Precipitation - summer or winter season 0.56285685
    2030A1BMk35M: Precipitation - wettest month 158.40222 mm
    2030A1BMk35M: Precipitation deficit - annual mean -24.509445 mm
    2030A1BMk35M: Precipitation deficit - month max -113.17 mm
    2030A1BMk35M: Precipitation deficit - month min 60.300003 mm
    2030A1BMk35M: Radiation - max month precipitation modified 24.464445 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 16.34074 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 8.583333 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 23.674353 degrees C
    2030A1BMk35M: Temperature - annual min mean 14.359537 degrees C
    2030A1BMk35M: Temperature - annual range 19.388885 degrees C
    2030A1BMk35M: Temperature - coldest month min 8.432222 degrees C
    2030A1BMk35M: Temperature - coolest month max 18.384445 degrees C
    2030A1BMk35M: Temperature - max difference in max 2.265564 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 2.675537 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 11.035553 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 9.314822 degrees C
    2030A1BMk35M: Temperature - min difference in max -2.9233398 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -2.8988953 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 7.8377686 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 27.821112 degrees C
    2030A1BMk35M: Temperature - warmest month min 19.634445 degrees C
    Precipitation - annual (Bio12) 1343.6666 mm
    Precipitation - coldest quarter (Bio19) 273.0 mm
    Precipitation - driest period (Bio14) 15.333333 mm
    Precipitation - driest quarter (Bio17) 224.66667 mm
    Precipitation - seasonality (Bio15) 29.0 mm
    Precipitation - warmest quarter (Bio18) 400.66666 mm
    Precipitation - wettest period (Bio13) 41.0 mm
    Precipitation - wettest quarter (Bio16) 455.33334 mm
    Precipitation deficit - annual mean -19.82112 mm
    Precipitation deficit - month max -106.68098 mm
    Radiation - annual mean (Bio20) 16.166668 MJ/m2/day
    Radiation - coldest quarter (Bio27) 10.5 MJ/m2/day
    Radiation - driest quarter (Bio25) 13.7 MJ/m2/day
    Radiation - highest period (Bio21) 24.5 MJ/m2/day
    Radiation - lowest period (Bio22) 8.3 MJ/m2/day
    Radiation - seasonality (Bio23) 34.0
    Radiation - warmest quarter (Bio26) 21.1 MJ/m2/day
    Radiation - wettest quarter (Bio24) 16.233334 MJ/m2/day
    Temperature - annual mean (Bio01) 17.7 degrees C
    Temperature - annual range (Bio07) 19.133333 degrees C
    Temperature - coldest period min (Bio06) 7.366667 degrees C
    Temperature - coldest quarter mean (Bio11) 13.0 degrees C
    Temperature - diurnal range mean (Bio02) 9.0 degrees C
    Temperature - driest quarter mean (Bio09) 14.133333 degrees C
    Temperature - isothermality (Bio03) 0.47 %
    Temperature - seasonality (Bio04) 1.2133334
    Temperature - warmest period max (Bio05) 26.466667 degrees C
    Temperature - warmest quarter (Bio10) 22.033333 degrees C
    Temperature - wettest quarter mean (Bio08) 20.633333 degrees C
    Wind run - annual mean 302.61182 km/day
    Wind run - month max 328.90717 km/day
    Wind run - month min 274.2408 km/day
    Wind speed - annual mean 3pm 6.3500814 m/s
    Wind speed - annual mean 9am 4.706066 m/s
    Wind speed - annual mean 9am or 3pm 6.0697355 m/s
    Wind speed - month max 3pm 7.1464906 m/s
    Wind speed - month max 9am 4.992981 m/s
    Wind speed - month max 9am or 3pm 7.1464906 m/s
    Wind speed - month min 3pm 5.392981 m/s
    Wind speed - month min 9am 4.266227 m/s
    Wind speed - month min 9am or 3pm 4.266227 m/s
    Distance
    Distance - to any water (weighted) 0.014142135 degrees
    Distance - to coast 0.0 km x 100
    Distance - to non-permanent water (weighted) 0.20124611 degrees
    Distance - to permanent water (weighted) 0.014142135 km
    Euclidean Distance to Coast (metres) 1104.06 m
    Marspec Distance to Shore 1.0 km
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    Marspec Annual Range in Sea Surface Salinity 0.24 100 x psu
    Marspec Annual Range in Sea Surface Temperature 5.58 100 x degrees C
    Marspec Annual Variance in Sea Surface Salinity 0.48999998 100 x psu
    Marspec Annual Variance in Sea Surface Temperature 4.1351 10,000 x degrees C
    Marspec Bathymetric Slope 0.4 10 x degrees
    Marspec Concavity 0.003 1000 x degrees
    Marspec East/West Aspect 0.87 radians
    Marspec Maximum Monthly Sea Surface Salinity 35.63 100 x psu
    Marspec Mean Annual Sea Surface Salinity 35.54 100 x psu
    Marspec Mean Annual Sea Surface Temperature 19.619999 100 x degrees C
    Marspec Minimum Monthly Sea Surface Salinity 35.39 100 x psu
    Marspec North/South Aspect -0.48 1 x radians
    Marspec Plan Curvature -2.9999999E-4 x 10000
    Marspec Profile Curvature -7.0E-4 x 10000
    Marspec Sea Surface Temperature of the coldest ice-free month 16.699999 100 x degrees C
    Marspec Sea Surface Temperature of the warmest ice-free month 22.279999 100 x degrees C
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.8196974
    2030A1BMk35M: Crop factor - month max 0.90000004
    2030A1BMk35M: Crop factor - month min 0.42058197
    2030A1BMk35M: Water deficit - month max 70.41206 mm
    2030A1BMk35M: Water deficit - month mean 12.042518 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -0.632761 MPa
    2030A1BMk35M: Water potential - month max -2.8643754E-14 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 73.77276
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 37.852375
    2030A1BMk35M: Water surplus - annual mean 3.3988063 mm
    2030A1BMk35M: Water surplus - month max 40.57556 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    Bouguer gravity anomalies 333.23083 Gal
    Bulk density 1.3318447 Mg/m^3
    Calcrete 0.0 presence
    Carbon store pre-European 129.6298 kgC/ha
    Clay % 17.031553 %
    Erosional surfaces - proportion 43.75 %
    Hydrologic conductivity - average saturated 55.454544 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 12.098 my
    Lithology - fertility 3.75 index
    Lithology - mean age 204.94484 my
    Lithology - mean age (log) 2.0106232 log my
    Lithology - mean age range (log) 1.0239341 log my
    Magnetic anomalies 12.0 nT
    Moisture Index - annual mean (Bio28) 0.86
    Moisture Index - coldest quarter mean (Bio35) 1.0
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 1.0
    Moisture Index - lowest period (Bio30) 0.43333334
    Moisture Index - lowest quarter mean (Bio33) 0.59
    Moisture Index - seasonality (Bio31) 20.333334
    Moisture Index - warmest quarter mean (Bio34) 0.66333336
    Nitrogen - plant-available pre-European 10348.43 kgN/ha
    Nitrogen concentration pre-European 64.62243 mgN kg/H2O
    Nitrogen store pre-European 216.356 kgN/ha
    Nutrient status 1.0 index
    Pedality hydrological score 1.8737864
    Phosphorus - plant-available pre-European 39.86679 kgP/ha
    Phosphorus - plant-available total pre-European 2083.5242 kgP/ha
    Phosphorus pre-European 11.90764 mgP kg/H2O
    Soil depth 1.1 m
    Soil pedality 1.8737864
    Soils - coarse 0.0 class
    Substrate data reliability 2.0
    Topographic wetness index 3.260754
    Unreliable water retention parameters 0.0
    Water holding capacity 58000.0 mm
    Water holding capacity - plant-available 147.0 mm
    Weathering Intensity V2 1.8377 Weathering Intensity Index
    Topography
    Averaged Topographic Relief 154.83333 metres
    Bathymetry and Topography 9 sec -4.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Topographic Slope (degrees) 1.1921384 degrees
    Topographic relief 84.15897 m
    Topographic roughness 3.875183 %
    Topographic slope (%) 2.426548 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 0.0
    Vegetation
    Enhanced Vegetation Index (2012-03-05) -7.0E-4 EVI
    Normalized Difference Vegetation Index (2012-03-05) -0.0218 NDVI
    Phenology peak day of year 2012 wet 17.914286 Day