Occurrence record:

EnvironmentalDNA of Sordariomycetes recorded on 2013-07-17

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2013-07-17
Date precision Day

Taxonomy

Scientific name Sordariomycetes
Taxon rank class
Kingdom Fungi
Phylum Ascomycota
Class Sordariomycetes
Order Sordariomycetes unclassified
Family Sordariomycetes unclassified
Genus Sordariomycetes unclassified
Species Sordariomycetes unclassified
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type wellformed

Geospatial

Country Australia
State / Province Tasmania
Locality Glamorgan/Spring Bay (M)
Locality Freycinet NP
Latitude -42.0578
Longitude 148.3021
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial
Verbatim elevation 17.0

Additional properties

ammonium nitrogen mg kg 7.0
amplicon ITS1FITS4_fungi
australian soil classification Rudosols
boron hot cacl2 mg kg 1.12
broad land use Conservation and Natural Environments
clay 10.48
color BR
conductivity dsm ds m 0.114
course sand 69.93
depth m 0.0
detailed land use Conservation and Natural Environments - Nature conservation - National park
dtpa copper mg kg 0.14
dtpa iron mg kg 53.91
dtpa manganese mg kg 12.56
dtpa zinc mg kg 1.3
environment Soil
exc aluminium meq 100g 0.034
exc calcium meq 100g 10.78
exc magnesium meq 100g 3.42
exc potassium meq 100g 0.34
exc sodium meq 100g 0.79
fine sand 15.35
general ecological zone Coastal
gravel 65.0
nitrate nitrogen mg kg 2.0
otu CCGAGTTTACAACTCCCAAACCCATTGAGAACCTTACCTTTGTTGCTTCGGCGGGACTGCCCCGGTGCCTTGCTGCCCGGATTCAGGCGCCCGCCGGAGACCCCAAACTCTTGTTTTAACTATGAGATTTTCTGATTGGTATAAACAAATAAATAA
otucount 15
organic carbon 4.33
ph level cacl2 cacl2 5.3
ph level h2o h2o 6.3
phosphorus colwell mg kg 6.0
potassium colwell mg kg 158.0
sample id 102.100.100/12438
sample type Soil
sand 85.28
silt 4.24
slope 5.0
soil moisture 17.5154944758825
sulphur mg kg 11.8
texture 1.5
vegetation type Woodland
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Altitude out of range Passed
    Altitude value non-numeric Passed
    Altitude value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 12 missing properties
    Show/Hide 45 tests that have not been run

    Additional political boundaries information

    Area Management
    CAPAD 2010 Terrestrial Freycinet
    CAPAD 2012 Terrestrial Freycinet
    CAPAD 2014 Terrestrial Freycinet
    CAPAD 2016 Terrestrial Freycinet
    Fallow practice - dominant (area) Fallow less than 3 months
    Fallow practice - dominant (number) Fallow less than 3 months
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Irrigation practice - dominant 6. Local knowledge
    Land use Plantations
    NRM Regions 2010 South
    NRM Regions 2014 South
    NRM Regions 2015 South
    NRM Regions 2017 South NRM Region
    NRM Regions 2017 (Qld 2019) South NRM Region
    Stubble practice - dominant (area) Stubble ploughed in
    Stubble practice - dominant (number) Stubble ploughed in
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 South NRM Region
    Biodiversity
    Freshwater Ecoregions of the World Southern Tasmania
    IBRA 6 Regions Tasmanian South East
    IBRA 6 Sub Regions South East
    IBRA 7 Regions Tasmanian South East
    IBRA 7 Subregions South East
    Terrestrial Ecoregional Boundaries Tasmanian Temperate Forests
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Hydrology
    Drainage Divisions Level 1 Tasmania
    Drainage Divisions Level 2 EAST COAST
    River Regions EAST COAST
    Marine
    Global Seagrass Species Richness (2003) 3.00000000
    Marine Ecoregions of the World Bassian
    States including coastal waters Tasmania (including Coastal Waters)
    Political
    ASGS Australian States and Territories Tasmania
    Australian States and Territories Tasmania
    Commonwealth Electoral Boundaries Lyons
    Local Government Areas 2011 Glamorgan/Spring Bay (M)
    Local Government Areas 2012 deprecated Glamorgan-Spring Bay
    Local Government Areas PSMA 2018 GLAMORGAN-SPRING BAY COUNCIL
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 0
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 931
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF TAS.
    PSMA ABS SA2 Statistical Areas (2016) TRIABUNNA - BICHENO
    PSMA ABS SA3 Statistical Areas (2016) SOUTH EAST COAST
    PSMA ABS SA4 Statistical Areas (2016) SOUTH EAST
    PSMA Commonwealth Electoral Boundaries (2016) LYONS
    PSMA Commonwealth Electoral Boundaries (2018) LYONS
    PSMA Indigenous Areas (2016) TASMANIA - SOUTH-EAST COAST
    PSMA Indigenous Locations (2016) GLAMORGAN - SPRING DAY
    PSMA Indigenous Regions (2016) TASMANIA
    PSMA Localities (2018) COLES BAY
    PSMA Remoteness Areas (2016) Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (TAS.)
    PSMA State Electoral Boundaries (2016) LYONS
    PSMA State Electoral Boundaries (2018) PROSSER
    PSMA States (2016) TASMANIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (TAS.)
    Statistical Local Areas Glamorgan/Spring Bay (M)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Northeast Tasmania Region
    Surface Geology of Australia Dgfc
    Topography
    Physiographic Provinces of Australia Tasmanian Uplands Province
    Physiographic Regions 2011 East Tasmanian Hills
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Native forest
    Forests of Australia (2013) v2.0 Eucalypt Medium Woodland
    Land cover Native shrublands and heathlands
    NVIS 4.1 Major Vegetation Groups Naturally bare - sand, rock, claypan, mudflat
    NVIS 4.1 Major Vegetation Subgroups Boulders/rock with algae, lichen or scattered plants, or alpine fjaeldmarks
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve
    Vegetation - condition Residual
    Vegetation types - native Low closed forests and closed shrublands
    Vegetation types - present Low closed forest and tall closed shrubland

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.6966
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.7782
    Endemism 0.013290713
    Endemism (Non-marine) 0.016388386
    Mammals – Fritz et al 2009 - 0.5 degree 0.2867
    Occurrence Density 5613.0 frequency
    Shannon Diversity (H) 4.8611817 index
    Species Richness 780.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.76285607
    2030A1BMk35M: Aridity index - month max 1.5677911
    2030A1BMk35M: Aridity index - month min 0.28530958
    2030A1BMk35M: Evaporation - annual mean 88.191246 mm
    2030A1BMk35M: Evaporation - month max 156.2775 mm
    2030A1BMk35M: Evaporation - month min 34.370834 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.059166666 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.36416668 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.04 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 78.72824 %
    2030A1BMk35M: Humidity - month max relative 3pm 82.19451 %
    2030A1BMk35M: Humidity - month min relative 3pm 75.61166 %
    2030A1BMk35M: Precipitation - annual mean 52.642082 mm
    2030A1BMk35M: Precipitation - driest month 36.76 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.0131111
    2030A1BMk35M: Precipitation - max difference between successive months 0.506457 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -0.8748633 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 1.1604642
    2030A1BMk35M: Precipitation - spring or autumn season 0.013024953
    2030A1BMk35M: Precipitation - summer or winter season 0.15941277
    2030A1BMk35M: Precipitation - wettest month 71.7275 mm
    2030A1BMk35M: Precipitation deficit - annual mean -35.549168 mm
    2030A1BMk35M: Precipitation deficit - month max -92.082504 mm
    2030A1BMk35M: Precipitation deficit - month min 19.623333 mm
    2030A1BMk35M: Radiation - max month precipitation modified 22.151667 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 13.958819 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 5.3425 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 18.419582 degrees C
    2030A1BMk35M: Temperature - annual min mean 9.318958 degrees C
    2030A1BMk35M: Temperature - annual range 17.136658 degrees C
    2030A1BMk35M: Temperature - coldest month min 5.534167 degrees C
    2030A1BMk35M: Temperature - coolest month max 14.021667 degrees C
    2030A1BMk35M: Temperature - max difference in max 1.7566528 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 1.7225037 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 9.6458435 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 9.100624 degrees C
    2030A1BMk35M: Temperature - min difference in max -2.5483398 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -2.0116882 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 8.199158 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 22.670834 degrees C
    2030A1BMk35M: Temperature - warmest month min 13.2075 degrees C
    Precipitation - annual (Bio12) 673.6 mm
    Precipitation - coldest quarter (Bio19) 159.8 mm
    Precipitation - driest period (Bio14) 9.4 mm
    Precipitation - driest quarter (Bio17) 146.6 mm
    Precipitation - seasonality (Bio15) 17.2 mm
    Precipitation - warmest quarter (Bio18) 177.4 mm
    Precipitation - wettest period (Bio13) 19.0 mm
    Precipitation - wettest quarter (Bio16) 207.4 mm
    Precipitation deficit - annual mean -31.469627 mm
    Precipitation deficit - month max -113.10247 mm
    Radiation - annual mean (Bio20) 13.8 MJ/m2/day
    Radiation - coldest quarter (Bio27) 6.9 MJ/m2/day
    Radiation - driest quarter (Bio25) 6.38 MJ/m2/day
    Radiation - highest period (Bio21) 22.46 MJ/m2/day
    Radiation - lowest period (Bio22) 5.1 MJ/m2/day
    Radiation - seasonality (Bio23) 46.0
    Radiation - warmest quarter (Bio26) 20.3 MJ/m2/day
    Radiation - wettest quarter (Bio24) 21.38 MJ/m2/day
    Temperature - annual mean (Bio01) 13.12 degrees C
    Temperature - annual range (Bio07) 17.08 degrees C
    Temperature - coldest period min (Bio06) 4.78 degrees C
    Temperature - coldest quarter mean (Bio11) 9.58 degrees C
    Temperature - diurnal range mean (Bio02) 8.98 degrees C
    Temperature - driest quarter mean (Bio09) 10.82 degrees C
    Temperature - isothermality (Bio03) 0.53 %
    Temperature - seasonality (Bio04) 0.968
    Temperature - warmest period max (Bio05) 21.88 degrees C
    Temperature - warmest quarter (Bio10) 16.66 degrees C
    Temperature - wettest quarter mean (Bio08) 15.5 degrees C
    Wind run - annual mean 142.9979 km/day
    Wind run - month max 173.70253 km/day
    Wind run - month min 116.16472 km/day
    Wind speed - annual mean 3pm 3.2333333 m/s
    Wind speed - annual mean 9am 2.0213172 m/s
    Wind speed - annual mean 9am or 3pm 3.45 m/s
    Wind speed - month max 3pm 4.0 m/s
    Wind speed - month max 9am 2.9 m/s
    Wind speed - month max 9am or 3pm 4.0 m/s
    Wind speed - month min 3pm 2.5 m/s
    Wind speed - month min 9am 1.4 m/s
    Wind speed - month min 9am or 3pm 1.4 m/s
    Distance
    Distance - to any water (weighted) 0.01 degrees
    Distance - to coast 0.01 km x 100
    Distance - to non-permanent water (weighted) 0.089999996 degrees
    Distance - to permanent water (weighted) 0.01 km
    Euclidean Distance to Coast (metres) 2034.544 m
    Marspec Distance to Shore 1.0 km
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    GEOMACS - geometric mean 0.068805 Pascals
    Marspec Annual Range in Sea Surface Salinity 0.32 100 x psu
    Marspec Annual Range in Sea Surface Temperature 5.45 100 x degrees C
    Marspec Annual Variance in Sea Surface Salinity 1.3199999 100 x psu
    Marspec Annual Variance in Sea Surface Temperature 4.0065 10,000 x degrees C
    Marspec Bathymetric Slope 0.3 10 x degrees
    Marspec Concavity 0.007 1000 x degrees
    Marspec East/West Aspect 0.47 radians
    Marspec Maximum Monthly Sea Surface Salinity 35.45 100 x psu
    Marspec Mean Annual Sea Surface Salinity 35.25 100 x psu
    Marspec Mean Annual Sea Surface Temperature 14.309999 100 x degrees C
    Marspec Minimum Monthly Sea Surface Salinity 35.13 100 x psu
    Marspec North/South Aspect 0.88 1 x radians
    Marspec Plan Curvature -4.0E-4 x 10000
    Marspec Profile Curvature -0.0011 x 10000
    Marspec Sea Surface Temperature of the coldest ice-free month 11.969999 100 x degrees C
    Marspec Sea Surface Temperature of the warmest ice-free month 17.42 100 x degrees C
    Sea Surface Temperature - MODIS Terra 14.280159 Degrees C
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.6782035
    2030A1BMk35M: Crop factor - month max 0.9
    2030A1BMk35M: Crop factor - month min 0.28530958
    2030A1BMk35M: Water deficit - month max 63.56749 mm
    2030A1BMk35M: Water deficit - month mean 19.543182 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -0.99642813 MPa
    2030A1BMk35M: Water potential - month max -0.12258428 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 61.038315
    2030A1BMk35M: Water stress index - month max 80.99999
    2030A1BMk35M: Water stress index - month min 25.67786
    2030A1BMk35M: Water surplus - annual mean 0.0 mm
    2030A1BMk35M: Water surplus - month max 0.0 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    Bouguer gravity anomalies 117.09551 Gal
    Bulk density 1.4598603 Mg/m^3
    Calcrete 0.0 presence
    Carbon store pre-European 162.84033 kgC/ha
    Clay % 20.046926 %
    Erosional surfaces - proportion 50.0 %
    Hydrologic conductivity - average saturated 157.76785 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 42.5 my
    Lithology - fertility 4.0 index
    Lithology - mean age 340.06 my
    Lithology - mean age (log) 2.52852 log my
    Lithology - mean age range (log) 1.5806733 log my
    Magnetic anomalies -57.0 nT
    Moisture Index - annual mean (Bio28) 0.688
    Moisture Index - coldest quarter mean (Bio35) 0.9
    Moisture Index - highest period (Bio29) 0.96
    Moisture Index - highest quarter mean (Bio32) 0.938
    Moisture Index - lowest period (Bio30) 0.282
    Moisture Index - lowest quarter mean (Bio33) 0.402
    Moisture Index - seasonality (Bio31) 30.8
    Moisture Index - warmest quarter mean (Bio34) 0.412
    Nitrogen - plant-available pre-European 13964.99 kgN/ha
    Nitrogen concentration pre-European 77.09419 mgN kg/H2O
    Nitrogen store pre-European 137.09534 kgN/ha
    Nutrient status 1.1 index
    Pedality hydrological score 2.3284917
    Phosphorus - plant-available pre-European 25.294033 kgP/ha
    Phosphorus - plant-available total pre-European 2143.959 kgP/ha
    Phosphorus pre-European 14.224031 mgP kg/H2O
    Soil depth 0.66 m
    Soil pedality 2.3284917
    Soils - coarse 0.0 class
    Substrate data reliability 1.8
    Topographic wetness index 1.564389
    Unreliable water retention parameters 22.5
    Water holding capacity - plant-available 105.28571 mm
    Weathering Intensity V2 2.66751 Weathering Intensity Index
    Topography
    Averaged Topographic Relief 230.83333 metres
    Bathymetry and Topography 9 sec 9.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Topographic Slope (degrees) 1.9653385 degrees
    Topographic relief 110.8714 m
    Topographic roughness 109.604 %
    Topographic slope (%) 9.861914 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 0.0
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3256 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 26.0 %
    Fractional Cover - Bare Soil (2012-03-05) 14.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 38.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 48.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.6 m^2 plant / m^2 ground
    Normalized Difference Vegetation Index (2012-03-05) 0.6425 NDVI
    Phenology peak day of year 2002 dry 113.457146 Day
    Phenology peak day of year 2012 wet 170.14285 Day