Occurrence record: BOLD - Australian records - 3747908

GenomicDNA of LEPIDOPTERA | Moths recorded on 2009-03-26

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3747908
Other catalogue numbers recordID:1651704;ProcessID:ANICK020-10;sampleID:10ANIC-07017
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Edwards, E.D.|Marriott, P.
Supplied as "E.D.Edwards, P.Marriott"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2009-03-26
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory New South Wales
Local government area Tumut Shire (A)
Locality Daners Gap
Latitude -35.22
Longitude 148.28
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HQ950178
markercode COI-5P
nucleotides AACATTATATTTCATTTTTGGAATTTGAGCAGGTATAGTTGGAACCTCATTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGATCTCTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATGGTAATACCCATTATAATTGGAGGATTTGGAAATTGACTTGTACCTTTAATACTTGGAGCTCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCACCTTCTTTAACTTTATTGATTTCAAGAAGAATTGTAGAAAGTGGAGCAGGAACAGGATGAACAGTTTATCCCCCCCTTTCATCTAATATTGCCCACGGGGGAAGATCTGTTGATTTAGCTATTTTTTCCCTTCATCTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTATCCTTCGATCAAATACCTTTATTTATTTGAGCTGTTGGGATTACTGCATTTTTATTATTACTATCATTACCTGTTTTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:43Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) Fallow less than 3 months
    Fallow practice - dominant (number) Fallow less than 3 months
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Irrigation practice - dominant Equal 5 and 6
    Land use Modified pastures
    Murray Darling Basin Authority Water Quality Zones Upland
    Murray-Darling Basin Boundary Murray-Darling Basin Boundary
    Murray-Darling Basin Ground Water Plan Areas GW11
    Murray-Darling Basin Ground Water Plan Areas (2018) NSW Murray���Darling Basin Fractured Rock
    Murray-Darling Basin Ground Water SDL Resource Units Lachlan Fold Belt (GS20)
    Murray-Darling Basin Ground Water SDL Resource Units (2018) Lachlan Fold Belt MDB (GS20)
    Murray-Darling Basin Surface Water Plan Areas SW9
    Murray-Darling Basin Surface Water Plan Areas (2019) Murrumbidgee
    Murray-Darling Basin Surface Water SDL Resource Units SS15
    Murray-Darling Basin Surface Water SDL Resource Units (2019) Murrumbidgee
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Valleys MURRUMBIDGEE
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Zones slopes
    NRM Regions 2010 Murrumbidgee
    NRM Regions 2014 Riverina
    NRM Regions 2015 Riverina
    NRM Regions 2017 Riverina
    NRM Regions 2017 (Qld 2019) Riverina
    Stubble practice - dominant (area) Removed by hot burn
    Stubble practice - dominant (number) Equal hot and cool burn
    Tillage practice - dominant (area) No cultivation
    Tillage practice - dominant (number) None = 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 Riverina
    Biodiversity
    Freshwater Ecoregions of the World Murray - Darling
    IBRA 6 Regions NSW South Western Slopes
    IBRA 6 Sub Regions Northern Inland Slopes, Upper Slopes
    IBRA 7 Regions NSW South Western Slopes
    IBRA 7 Subregions Inland Slopes
    Terrestrial Ecoregional Boundaries Southeast Australia Temperate Forests
    World Anthropogenic Biomes (2000) Populated croplands
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Koppen Climate Classification (All Classes) Temperate: no dry season (warm summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Pasture, cropland (temperate)
    Hydrology
    Drainage Divisions Level 1 Murray-Darling Basin
    Drainage Divisions Level 2 DARLING RIVER
    River Regions MURRUMBIDGEE RIVER
    Marine
    Marine Ecoregions of the World Cape Howe
    States including coastal waters New South Wales (including Coastal Waters)
    Political
    ASGS Australian States and Territories New South Wales
    Australian States and Territories New South Wales
    Commonwealth Electoral Boundaries Riverina
    Indigenous Land Use Agreements Tumut Brungle Area Agreement
    Local Government Areas 2011 Tumut Shire (A)
    Local Government Areas 2012 deprecated Tumut
    Local Government Areas PSMA 2018 SNOWY VALLEYS COUNCIL
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water Barkindji, Gomeroi/Kamilaroi, Maljangapa, Ngiyampaa, Wailwan, Wiradjuri
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water (2019) Barkandji, Barapa Barapa, Bigambul, Budjiti, Euahlayi, Githabul, Gomeroi/Kamilaroi, Guwamu (Kooma), Kambuwal, Kunja, Kwiambul, Maljangapa, Maraura, Murrawarri, Mutthi Mutthi, Nari Nari, Ngarabal, Ngemba, Ngiyampaa, Nyeri Nyeri, Tati Tati, Wadi Wadi, Wail
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water Barapa Barapa, Muthi Muthi, Nari Nari, Nyeri Nyeri, Wadi Wadi, Walgalul, Wamba Wamba, Weki Weki, Wiradjuri
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water (2019) Barapa Barapa, Mutthi Mutthi, Nari Nari, Nyeri Nyeri, Wadi Wadi, Wolgalu, Wemba Wemba, Weki Weki, Wiradjuri
    NSW Local Land Services Regions Riverina
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 3
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 480
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF NSW
    PSMA ABS SA2 Statistical Areas (2016) TUMUT REGION
    PSMA ABS SA3 Statistical Areas (2016) TUMUT - TUMBARUMBA
    PSMA ABS SA4 Statistical Areas (2016) RIVERINA
    PSMA Commonwealth Electoral Boundaries (2016) EDEN-MONARO
    PSMA Commonwealth Electoral Boundaries (2018) EDEN-MONARO
    PSMA Indigenous Areas (2016) TUMUT
    PSMA Indigenous Locations (2016) TUMUT
    PSMA Indigenous Regions (2016) RIVERINA - ORANGE
    PSMA Localities (2018) WYANGLE
    PSMA Remoteness Areas (2016) Inner Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (NSW)
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) LEGISLATIVE COUNCIL
    PSMA States (2016) NEW SOUTH WALES
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (NSW)
    Statistical Local Areas Tumut Shire (A)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Lachlan Region
    Surface Geology of Australia Stbw
    Topography
    Physiographic Provinces of Australia Kosciuszkan Uplands Province
    Physiographic Regions 2011 Hume Slopes
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Other special rights, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Native grasslands and minimally modified pastures
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Transformed
    Vegetation types - native Eucalypt open forests
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 1.3140907E7 $
    Area management
    Phosphorus 0.015123 t/ha
    Potassium 0.069657 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.7225
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.3324
    Endemism 0.00258869
    Endemism (Non-marine) 0.0031239882
    Mammals – Fritz et al 2009 - 0.5 degree 0.3689
    Migratory species (2008) 5.0 frequency
    Occurrence Density 9554.0 frequency
    Shannon Diversity (H) 5.2140226 index
    Species Richness 773.0 frequency
    Threatened communities (2008) 1.0 frequency
    Threatened species (2008) 2.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.9760978
    2030A1BMk35M: Evaporation - month min 32.85 mm
    2030A1BMk35M: Precipitation - annual mean 64.565 mm
    2030A1BMk35M: Precipitation - driest month 43.52 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.1685467
    2030A1BMk35M: Precipitation - spring or autumn season 0.16754143
    2030A1BMk35M: Temperature - annual max mean 22.4875 degrees C
    2030A1BMk35M: Temperature - annual min mean 8.603333 degrees C
    2030A1BMk35M: Temperature - annual range 29.080017 degrees C
    Aridity index - annual mean 1.0194602
    Aridity index - month max 2.6607814
    Aridity index - month min 0.24147674
    Evaporation - annual mean 121.5494 (ml/5km x 5km pixel)
    Evaporation - average 18712.0 ml
    Evaporation - month max 245.97713 mm
    Evaporation - month min 33.73233 mm
    Evaporation - variability 12.0 %
    Growth index C3 macrotherm plants - annual mean 0.07 index
    Growth index C3 mesotherm plants - annual mean 0.3 index
    Growth index C4 megatherm plants - annual mean 0.05 index
    Humidity - annual mean relative 82.12633 %
    Humidity - annual mean relative 3pm 65.601105 %
    Humidity - month max relative 97.29738 %
    Humidity - month max relative 3pm 79.13622 %
    Humidity - month min relative 52.075485 %
    Humidity - month min relative 3pm 52.075485 %
    Precipitation - annual 764.0 mm
    Precipitation - annual (Bio12) 867.0 mm
    Precipitation - annual mean 71.65222 mm
    Precipitation - annual seasonality -0.28894478
    Precipitation - coldest quarter (Bio19) 285.0 mm
    Precipitation - driest month 46.981388 mm
    Precipitation - driest period (Bio14) 10.0 mm
    Precipitation - driest quarter (Bio17) 143.0 mm
    Precipitation - equinox seasonality ratio 1.0926706
    Precipitation - seasonality (Bio15) 26.0 mm
    Precipitation - spring or autumn season 0.09222363
    Precipitation - warmest quarter (Bio18) 163.0 mm
    Precipitation - wettest month 93.28643 mm
    Precipitation - wettest period (Bio13) 26.0 mm
    Precipitation - wettest quarter (Bio16) 289.0 mm
    Radiation - annual mean (Bio20) 16.5 MJ/m2/day
    Radiation - seasonality (Bio23) 41.0
    Radiation - warmest quarter (Bio26) 24.0 MJ/m2/day
    Temperature - annual max mean 20.259167 degrees C
    Temperature - annual mean (Bio01) 14.3 degrees C
    Temperature - annual min mean 6.8816667 degrees C
    Temperature - annual range 27.489838 degrees C
    Temperature - annual range (Bio07) 29.3 degrees C
    Temperature - coldest month min 1.07 degrees C
    Temperature - coldest period min (Bio06) 1.2 degrees C
    Temperature - coldest quarter mean (Bio11) 7.5 degrees C
    Temperature - diurnal range mean (Bio02) 13.6 degrees C
    Temperature - driest quarter mean (Bio09) 18.6 degrees C
    Temperature - isothermality (Bio03) 0.47 %
    Temperature - month hottest maximum 29.1 degrees C
    Temperature - seasonality (Bio04) 1.9
    Temperature - warmest month min 13.44 degrees C
    Temperature - warmest period max (Bio05) 30.5 degrees C
    Temperature - warmest quarter (Bio10) 21.4 degrees C
    Temperature - wettest quarter mean (Bio08) 7.9 degrees C
    Wind run - annual mean 151.00877 km/day
    WorldClim: Precipitation - annual 902.0 mm
    WorldClim: Precipitation - coldest quarter 267.0 mm
    WorldClim: Precipitation - driest month 46.0 mm
    WorldClim: Precipitation - driest quarter 171.0 mm
    WorldClim: Precipitation - seasonality 21.0
    WorldClim: Precipitation - warmest quarter 171.0 mm
    WorldClim: Precipitation - wettest month 99.0 mm
    WorldClim: Precipitation - wettest quarter 277.0 mm
    WorldClim: Temperature - annual mean 143.0 degrees C * 10
    WorldClim: Temperature - annual range 297.0 degrees C * 10
    WorldClim: Temperature - coldest month min 9.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 74.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 141.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 212.0 degrees C * 10
    WorldClim: Temperature - isothermality 47.0 %
    WorldClim: Temperature - seasonality 5487.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 306.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 215.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 84.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.04 degrees
    Distance - to coast 1.98154 km x 100
    Distance - to non-permanent water (weighted) 0.089999996 degrees
    Distance - to permanent water (weighted) 0.04 km
    Euclidean Distance to Coast (metres) 93173.664 m
    Remoteness index 2.2476752
    Hydrology
    Drainage - average 2678.0 megalitres/5x5km/year
    Drainage - variability 53.0 %
    Runoff - average 2180.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 2.4 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 81.0
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 52.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.62 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 21.0 %
    Bulk density 1.4753251 Mg/m^3
    Carbon - organic 1.3963428 %
    Clay % 36.838234 %
    Hydrologic conductivity - average saturated 53.333332 mm/h
    Moisture Index - annual mean (Bio28) 0.67
    Moisture Index - highest quarter mean (Bio32) 1.0
    Nutrient status 1.85 index
    Ph - soil 4.0 ph
    Soil depth 0.8 m
    Soil pedality 3.1778638
    Water holding capacity 42000.0 mm
    Water stress index - month max 80.99999
    Weathering Intensity V2 1.56449 Weathering Intensity Index
    Topography
    Aspect 193.0 degrees
    Averaged Topographic Relief 456.45834 metres
    Bathymetry and Topography 9 sec 355.0 m
    Elevation 615.0 m
    Topographic Slope (degrees) 19.092129 degrees
    Topographic relief 75.82059 m
    Topographic slope (%) 4.556943 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3666 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 58.0 %
    Fractional Cover - Bare Soil (2012-03-05) 0.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 29.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 71.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0326 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 1.4 m^2 plant / m^2 ground
    NDVI Mean 61.0 NDVI x 100
    NPP Mean 5.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.6505 NDVI