We have just released new data filter features to improve the way you search and filter data in the ALA. There is now a default data filter in place that excludes lower quality records. You can pre-filter your search results using a suite of other data filters. To learn more, read Getting started with the data profiles.

Occurrence record: BOLD - Australian records - 3561702

GenomicDNA of LEPIDOPTERA | Moths recorded on 2007-01-16

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3561702
Other catalog numbers recordID:1414958;ProcessID:GWORW287-10;sampleID:BC EF Lep 01261
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector Friedrich, E.
Supplied as "E. Friedrich"
Reproductive condition sexual
Sex female
Life stage adult
License CC-BY-Int
Field number BC EF Lep 01261
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Egbert Friedrich

Event

Field number BC EF Lep 01261
Occurrence date 2007-01-16
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Queensland
Locality Maranoa (R)
Locality Caravan Park
Latitude -25.8439
Longitude 148.569
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HM911984
markercode COI-5P
nucleotides AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTACTTATTCGTGCAGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACCATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATGCCTATTATAATTGGAGGATTTGGAAATTGACTTGTTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTCTGACTTCTTCCCCCCTCATTAACTTTATTAATTTCGAGTAGAATTGTAGAAAATGGAGCAGGTACTGGATGAACAGTTTACCCACCTCTTTCATCTAATATTGCTCACGGAGGAAGTTCTGTAGACTTAGCAATTTTTTCTTTACATTTAGCTGGAATTTCCTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGTTTAAATAATTTATCTTTTGATCAAATACCATTATTTATTTGAGCAGTAGGAATTACAGCATTTTTATTATTATTATCTTTACCTGTCTTAGCAGGAGCTATTACAATACTTTTAACTGATCGTAATTTAAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Owner institution code Research Collection of Egbert Friedrich
sequence last updated 2011-11-14T08:11:19Z

User flagged issues 

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) Fallow 3-9 months
    Fallow practice - dominant (number) Fallow 3-9 months
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Irrigation practice - dominant No irrigation
    Land use Grazing of native pastures
    NRM Regions 2010 Fitzroy
    NRM Regions 2014 Fitzroy
    NRM Regions 2015 Fitzroy
    NRM Regions 2017 Fitzroy
    NRM Regions 2017 (Qld 2019) Fitzroy
    Stubble practice - dominant (area) Stubble ploughed in
    Stubble practice - dominant (number) Stubble ploughed in
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 Fitzroy
    Biodiversity
    Freshwater Ecoregions of the World Eastern Coastal Australia
    IBRA 6 Regions Brigalow Belt South
    IBRA 6 Sub Regions Southern Downs
    IBRA 7 Regions Brigalow Belt South
    IBRA 7 Subregions Southern Downs
    Terrestrial Ecoregional Boundaries Brigalow Tropical Savanna
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Growth is limited by moisture rather than temperature and the winters are mild. Growth is relatively even through the year
    Koppen Climate Classification (All Classes) Subtropical: moderately dry winter
    Koppen Climate Classification (Major Classes) Subtropical
    Fire
    Fire regime niches Pasture (tropical and subtropical)
    Hydrology
    Drainage Divisions Level 1 North East Coast
    Drainage Divisions Level 2 FITZROY RIVER (QLD)
    River Regions FITZROY RIVER (QLD)
    Marine
    Marine Ecoregions of the World Central and Southern Great Barrier Reef
    States including coastal waters Queensland (including Coastal Waters)
    Political
    ASGS Australian States and Territories Queensland
    Australian States and Territories Queensland
    Commonwealth Electoral Boundaries Maranoa
    Local Government Areas 2011 Maranoa (R)
    Local Government Areas 2012 deprecated Bungil
    Local Government Areas PSMA 2018 MARANOA REGIONAL
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 3
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 910
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF QLD
    PSMA ABS SA2 Statistical Areas (2016) ROMA REGION
    PSMA ABS SA3 Statistical Areas (2016) DARLING DOWNS (WEST) - MARANOA
    PSMA ABS SA4 Statistical Areas (2016) DARLING DOWNS - MARANOA
    PSMA Commonwealth Electoral Boundaries (2016) MARANOA
    PSMA Commonwealth Electoral Boundaries (2018) MARANOA
    PSMA Indigenous Areas (2016) MARANOA - ROMA - MITCHELL
    PSMA Indigenous Locations (2016) MARANOA EXC. ROMA AND MITCHELL
    PSMA Indigenous Regions (2016) TOOWOOMBA - ROMA
    PSMA Localities (2018) INJUNE
    PSMA Remoteness Areas (2016) Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (QLD)
    PSMA State Electoral Boundaries (2016) WARREGO
    PSMA State Electoral Boundaries (2018) WARREGO
    PSMA States (2016) QUEENSLAND
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (QLD)
    Statistical Local Areas Maranoa (R) - Bungil
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Surat Region
    Surface Geology of Australia Jsi
    Topography
    Physiographic Provinces of Australia New England-Moreton Uplands Province
    Physiographic Regions 2011 Taroom Hills
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    IGBP Land Cover vegetation classification scheme (2011) Woody savannas
    Land cover Native grasslands and minimally modified pastures
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Replaced
    Vegetation types - native Eucalypt woodlands
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 8490900.0 $
    Area management
    Phosphorus 0.0075 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.8809
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.9917
    Endemism 0.13821901
    Endemism (Non-marine) 0.1383425
    Mammals – Fritz et al 2009 - 0.5 degree 0.3689
    Migratory species (2008) 3.0 frequency
    Occurrence Density 1276.0 frequency
    Shannon Diversity (H) 5.0159135 index
    Species Richness 333.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 5.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.21810165
    2030A1BMk35M: Evaporation - month min 88.62 mm
    2030A1BMk35M: Precipitation - annual mean 42.622498 mm
    2030A1BMk35M: Precipitation - driest month 10.37 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.8568396
    2030A1BMk35M: Precipitation - spring or autumn season -0.1655605
    2030A1BMk35M: Temperature - annual max mean 29.225834 degrees C
    2030A1BMk35M: Temperature - annual min mean 13.3758335 degrees C
    2030A1BMk35M: Temperature - annual range 30.880005 degrees C
    Aridity index - annual mean 0.2997045
    Aridity index - month max 0.39941588
    Aridity index - month min 0.14911616
    Evaporation - annual mean 166.5413 (ml/5km x 5km pixel)
    Evaporation - average 14215.0 ml
    Evaporation - month max 260.5703 mm
    Evaporation - month min 74.07108 mm
    Evaporation - variability 18.0 %
    Growth index C3 macrotherm plants - annual mean 0.16 index
    Growth index C3 mesotherm plants - annual mean 0.22 index
    Growth index C4 megatherm plants - annual mean 0.13 index
    Humidity - annual mean relative 70.727905 %
    Humidity - annual mean relative 3pm 54.112698 %
    Humidity - month max relative 83.54882 %
    Humidity - month max relative 3pm 63.122036 %
    Humidity - month min relative 47.065376 %
    Humidity - month min relative 3pm 47.065376 %
    Precipitation - annual 606.0 mm
    Precipitation - annual (Bio12) 594.0 mm
    Precipitation - annual mean 49.94237 mm
    Precipitation - annual seasonality 1.3592651
    Precipitation - coldest quarter (Bio19) 84.0 mm
    Precipitation - driest month 23.0 mm
    Precipitation - driest period (Bio14) 3.0 mm
    Precipitation - driest quarter (Bio17) 71.0 mm
    Precipitation - equinox seasonality ratio 0.971223
    Precipitation - seasonality (Bio15) 45.0 mm
    Precipitation - spring or autumn season -0.029411765
    Precipitation - warmest quarter (Bio18) 238.0 mm
    Precipitation - wettest month 84.0 mm
    Precipitation - wettest period (Bio13) 21.0 mm
    Precipitation - wettest quarter (Bio16) 238.0 mm
    Radiation - annual mean (Bio20) 19.7 MJ/m2/day
    Radiation - seasonality (Bio23) 24.0
    Radiation - warmest quarter (Bio26) 24.5 MJ/m2/day
    Temperature - annual max mean 27.208334 degrees C
    Temperature - annual mean (Bio01) 19.8 degrees C
    Temperature - annual min mean 12.039166 degrees C
    Temperature - annual range 29.571106 degrees C
    Temperature - annual range (Bio07) 31.1 degrees C
    Temperature - coldest month min 3.6 degrees C
    Temperature - coldest period min (Bio06) 3.0 degrees C
    Temperature - coldest quarter mean (Bio11) 12.4 degrees C
    Temperature - diurnal range mean (Bio02) 15.6 degrees C
    Temperature - driest quarter mean (Bio09) 13.6 degrees C
    Temperature - isothermality (Bio03) 0.5 %
    Temperature - month hottest maximum 33.54 degrees C
    Temperature - seasonality (Bio04) 1.85
    Temperature - warmest month min 19.25 degrees C
    Temperature - warmest period max (Bio05) 34.1 degrees C
    Temperature - warmest quarter (Bio10) 26.2 degrees C
    Temperature - wettest quarter mean (Bio08) 26.2 degrees C
    Wind run - annual mean 157.65495 km/day
    WorldClim: Precipitation - annual 654.0 mm
    WorldClim: Precipitation - coldest quarter 90.0 mm
    WorldClim: Precipitation - driest month 23.0 mm
    WorldClim: Precipitation - driest quarter 85.0 mm
    WorldClim: Precipitation - seasonality 47.0
    WorldClim: Precipitation - warmest quarter 279.0 mm
    WorldClim: Precipitation - wettest month 99.0 mm
    WorldClim: Precipitation - wettest quarter 279.0 mm
    WorldClim: Temperature - annual mean 195.0 degrees C * 10
    WorldClim: Temperature - annual range 305.0 degrees C * 10
    WorldClim: Temperature - coldest month min 30.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 120.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 156.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 136.0 degrees C * 10
    WorldClim: Temperature - isothermality 51.0 %
    WorldClim: Temperature - seasonality 5369.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 335.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 258.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 258.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 3.25977 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.044721358 km
    Euclidean Distance to Coast (metres) 302423.53 m
    Remoteness index 9.308702
    Hydrology
    Drainage - average 28.0 megalitres/5x5km/year
    Drainage - variability 249.0 %
    Runoff - average 934.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Marine
    Great Barrier Reef 100m DEM 383.4 m
    Social
    Population - density SLA 2006 p/sqkm) 0.2 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 27.474676
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 50.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.49 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 36.0 %
    Bulk density 1.6572629 Mg/m^3
    Carbon - organic 0.44729346 %
    Clay % 48.358402 %
    Hydrologic conductivity - average saturated 9.0 mm/h
    Moisture Index - annual mean (Bio28) 0.3
    Moisture Index - highest quarter mean (Bio32) 0.37
    Nutrient status 1.85 index
    Ph - soil 6.0 ph
    Soil depth 0.9 m
    Soil pedality 3.6901083
    Water holding capacity 33000.0 mm
    Water stress index - month max 35.94743
    Weathering Intensity V2 4.15628 Weathering Intensity Index
    Topography
    Aspect 120.0 degrees
    Averaged Topographic Relief 69.541664 metres
    Bathymetry and Elvation 9 sec 387.0 m
    Elevation 384.0 m
    Topographic Slope (degrees) 0.6980068 degrees
    Topographic relief 12.2767 m
    Topographic slope (%) 0.6248655 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3792 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 59.0 %
    Fractional Cover - Bare Soil (2012-03-05) 19.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 33.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 48.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0146 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 1.6 m^2 plant / m^2 ground
    NDVI Mean 42.0 NDVI x 100
    NPP Mean 5.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.6956 NDVI