Occurrence record:

EnvironmentalDNA of Fungi recorded on 2016-09-02

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated sequences https://www.ncbi.nlm.nih.gov/biosample/SAMN07449135
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2016-09-02
Date precision Day

Taxonomy

Scientific name Fungi
Taxon rank kingdom
Kingdom Fungi
Phylum Fungi unclassified
Class Fungi unclassified
Order Fungi unclassified
Family Fungi unclassified
Genus Fungi unclassified
Species Fungi unclassified
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province South Australia
Locality Playford (C)
Locality City of Playford
Latitude -34.721805
Longitude 138.692351
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial
Verbatim elevation 86.0

Additional properties

ammonium nitrogen mg kg 3.0
amplicon ITS1FITS4_fungi
boron hot cacl2 mg kg 1.53
clay 30.2
color BRGR
conductivity dsm ds m 0.164
course sand 10.01
depth m 20.0
detailed land use Intensive Uses - Residential and farm infrastructure - Urban residential
dtpa copper mg kg 1.55
dtpa iron mg kg 22.87
dtpa manganese mg kg 15.47
dtpa zinc mg kg 0.41
environment Soil
exc aluminium meq 100g 0.104
exc calcium meq 100g 17.94
exc magnesium meq 100g 4.82
exc potassium meq 100g 1.48
exc sodium meq 100g 1.06
fine sand 44.67
general ecological zone Temperate
gravel 5.0
ncbi bioproject accession PRJNA317932
ncbi biosample accession SAMN07449135
nitrate nitrogen mg kg 2.0
otu CAGAGTTATGGGCCCCCTTATGGGGGTGTAGACTTGTAACCCCTATGTTGTATTTGACTTTTGTTGCTTTGGCAGGTCGTAAAGCCTTAAAGCTTTTCCATTGGCTTCGGCTAGTGTTTACCCGCCAGAGGACCCCAAACTCTTGAAAAAACAAAATTTTTATTGTCAGTTACTATTTACAATAGTTTAA
otucount 1
organic carbon 1.16
ph level cacl2 cacl2 7.4
ph level h2o h2o 8.3
phosphorus colwell mg kg 2.0
potassium colwell mg kg 541.0
sample id 102.100.100/39120
sample type Soil
sand 54.68
silt 15.12
slope 5.5
sulphur mg kg 8.7
texture 3.5
vegetation type Grassland
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Altitude out of range Passed
    Altitude value non-numeric Passed
    Altitude value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 12 missing properties
    Show/Hide 45 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Global 200 priority ecoregions - Terrestrial Southern Australia Mallee and Woodlands
    Irrigation practice - dominant No irrigation
    Land use Urban intensive uses
    NRM Regions 2010 Adelaide and Mount Lofty Ranges
    NRM Regions 2014 Adelaide and Mount Lofty Ranges
    NRM Regions 2015 Adelaide and Mount Lofty Ranges
    NRM Regions 2017 Adelaide and Mount Lofty Ranges
    NRM Regions 2017 (Qld 2019) Adelaide and Mount Lofty Ranges
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Adelaide and Mount Lofty Ranges
    Biodiversity
    Freshwater Ecoregions of the World Murray - Darling
    IBRA 6 Regions Flinders Lofty Block
    IBRA 6 Sub Regions Mount Lofty Ranges
    IBRA 7 Regions Flinders Lofty Block
    IBRA 7 Subregions Mount Lofty Ranges
    Terrestrial Ecoregional Boundaries Tirari-Sturt Stony Desert
    World Anthropogenic Biomes (2000) Urban
    Climate
    Agroclimatic classification of Australia "Mediterranean" climate, but with drier cooler winters and less growth than Classic "Mediterranean" climate
    Koppen Climate Classification (All Classes) Temperate: distinctly dry (and hot) summer
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Pasture, cropland (temperate)
    Hydrology
    Drainage Divisions Level 1 South Australian Gulf
    Drainage Divisions Level 2 GAWLER RIVER
    River Regions GAWLER RIVER
    Marine
    Marine Ecoregions of the World South Australian Gulfs
    States including coastal waters South Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories South Australia
    Australian States and Territories South Australia
    Commonwealth Electoral Boundaries Wakefield
    Local Government Areas 2011 Playford (C)
    Local Government Areas 2012 deprecated Playford - East Central
    Local Government Areas PSMA 2018 CITY OF PLAYFORD
    Native Title Determinations (13/7/2020) Kaurna Peoples Native Title Claim SCD2018/001
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 84
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 3092
    PSMA ABS Greater Capital City Statistical Areas (2016) GREATER ADELAIDE
    PSMA ABS SA2 Statistical Areas (2016) ELIZABETH EAST
    PSMA ABS SA3 Statistical Areas (2016) PLAYFORD
    PSMA ABS SA4 Statistical Areas (2016) ADELAIDE - NORTH
    PSMA Commonwealth Electoral Boundaries (2016) WAKEFIELD
    PSMA Commonwealth Electoral Boundaries (2018) SPENCE
    PSMA Indigenous Areas (2016) PLAYFORD
    PSMA Indigenous Locations (2016) PLAYFORD - EAST
    PSMA Indigenous Regions (2016) ADELAIDE
    PSMA Localities (2018) MUNNO PARA
    PSMA Remoteness Areas (2016) Major Cities of Australia
    PSMA Section of State (2016) MAJOR URBAN
    PSMA Section of State Range (2016) 1 MILLION OR MORE
    PSMA Significant Urban Area (2016) ADELAIDE
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) LEGISLATIVE COUNCIL
    PSMA States (2016) SOUTH AUSTRALIA
    PSMA Urban Centre and Locality (2016) ADELAIDE
    PSMA Wards (2018) WARD 6
    Statistical Local Areas Playford (C) - East Central
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia St Vincent Region
    Surface Geology of Australia Qrc
    Topography
    Physiographic Provinces of Australia Gulfs Ranges Province
    Physiographic Regions 2011 Flinders-Lofty Ranges
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Built-up
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Other Crown Land
    Vegetation - condition Removed
    Vegetation types - native Eucalypt woodlands
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 7775071.0 $
    Area management
    Phosphorus -92.03766 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 1.7548
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.1378
    Endemism 0.017485311
    Endemism (Non-marine) 0.019491833
    Mammals – Fritz et al 2009 - 0.5 degree 0.5124
    Migratory species (2008) 3.0 frequency
    Occurrence Density 49195.0 frequency
    Shannon Diversity (H) 5.359312 index
    Species Richness 1784.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 6.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.43204746
    2030A1BMk35M: Evaporation - month min 52.46 mm
    2030A1BMk35M: Precipitation - annual mean 38.718334 mm
    2030A1BMk35M: Precipitation - driest month 13.06 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.2704494
    2030A1BMk35M: Precipitation - spring or autumn season 0.26783815
    2030A1BMk35M: Temperature - annual max mean 23.201666 degrees C
    2030A1BMk35M: Temperature - annual min mean 11.712501 degrees C
    2030A1BMk35M: Temperature - annual range 24.150024 degrees C
    Aridity index - annual mean 0.5540081
    Aridity index - month max 1.3955059
    Aridity index - month min 0.08586119
    Evaporation - annual mean 138.3174 (ml/5km x 5km pixel)
    Evaporation - average 11424.0 ml
    Evaporation - month max 256.2275 mm
    Evaporation - month min 47.455753 mm
    Evaporation - variability 10.0 %
    Growth index C3 macrotherm plants - annual mean 0.05 index
    Growth index C3 mesotherm plants - annual mean 0.26 index
    Growth index C4 megatherm plants - annual mean 0.03 index
    Humidity - annual mean relative 75.57864 %
    Humidity - annual mean relative 3pm 65.60493 %
    Humidity - month max relative 89.87382 %
    Humidity - month max relative 3pm 79.231544 %
    Humidity - month min relative 52.518517 %
    Humidity - month min relative 3pm 52.518517 %
    Precipitation - annual 453.0 mm
    Precipitation - annual (Bio12) 527.0 mm
    Precipitation - annual mean 45.894016 mm
    Precipitation - annual seasonality -1.1013299
    Precipitation - coldest quarter (Bio19) 211.0 mm
    Precipitation - driest month 22.0 mm
    Precipitation - driest period (Bio14) 3.0 mm
    Precipitation - driest quarter (Bio17) 59.0 mm
    Precipitation - equinox seasonality ratio 1.0552514
    Precipitation - seasonality (Bio15) 47.0 mm
    Precipitation - spring or autumn season 0.05483663
    Precipitation - warmest quarter (Bio18) 59.0 mm
    Precipitation - wettest month 72.23003 mm
    Precipitation - wettest period (Bio13) 18.0 mm
    Precipitation - wettest quarter (Bio16) 211.0 mm
    Radiation - annual mean (Bio20) 17.4 MJ/m2/day
    Radiation - seasonality (Bio23) 42.0
    Radiation - warmest quarter (Bio26) 25.7 MJ/m2/day
    Temperature - annual max mean 21.44 degrees C
    Temperature - annual mean (Bio01) 16.5 degrees C
    Temperature - annual min mean 10.5175 degrees C
    Temperature - annual range 22.770142 degrees C
    Temperature - annual range (Bio07) 24.4 degrees C
    Temperature - coldest month min 5.99 degrees C
    Temperature - coldest period min (Bio06) 6.0 degrees C
    Temperature - coldest quarter mean (Bio11) 11.1 degrees C
    Temperature - diurnal range mean (Bio02) 11.3 degrees C
    Temperature - driest quarter mean (Bio09) 22.1 degrees C
    Temperature - isothermality (Bio03) 0.46 %
    Temperature - month hottest maximum 28.8 degrees C
    Temperature - seasonality (Bio04) 1.51
    Temperature - warmest month min 15.38 degrees C
    Temperature - warmest period max (Bio05) 30.4 degrees C
    Temperature - warmest quarter (Bio10) 22.2 degrees C
    Temperature - wettest quarter mean (Bio08) 11.1 degrees C
    Wind run - annual mean 267.9676 km/day
    WorldClim: Precipitation - annual 538.0 mm
    WorldClim: Precipitation - coldest quarter 203.0 mm
    WorldClim: Precipitation - driest month 18.0 mm
    WorldClim: Precipitation - driest quarter 60.0 mm
    WorldClim: Precipitation - seasonality 44.0
    WorldClim: Precipitation - warmest quarter 63.0 mm
    WorldClim: Precipitation - wettest month 71.0 mm
    WorldClim: Precipitation - wettest quarter 205.0 mm
    WorldClim: Temperature - annual mean 161.0 degrees C * 10
    WorldClim: Temperature - annual range 233.0 degrees C * 10
    WorldClim: Temperature - coldest month min 60.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 107.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 114.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 215.0 degrees C * 10
    WorldClim: Temperature - isothermality 48.0 %
    WorldClim: Temperature - seasonality 4280.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 293.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 215.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 115.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.089999996 degrees
    Distance - to coast 0.1627882 km x 100
    Distance - to non-permanent water (weighted) 0.089999996 degrees
    Distance - to permanent water (weighted) 0.12165525 km
    Euclidean Distance to Coast (metres) 13472.292 m
    Remoteness index 0.0
    Hydrology
    Drainage - average 586.0 megalitres/5x5km/year
    Drainage - variability 83.0 %
    Runoff - average 85.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Substrate
    2030A1BMk35M: Water stress index - month max 80.99999
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 45.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.63 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 30.0 %
    Bulk density 1.2677184 Mg/m^3
    Carbon - organic 0.8651943 %
    Clay % 33.305824 %
    Hydrologic conductivity - average saturated 100.0 mm/h
    Moisture Index - annual mean (Bio28) 0.47
    Moisture Index - highest quarter mean (Bio32) 0.92
    Nutrient status 2.0 index
    Ph - soil 7.0 ph
    Soil depth 0.6 m
    Soil pedality 3.4626215
    Water holding capacity 24000.0 mm
    Water stress index - month max 81.0
    Weathering Intensity V2 2.42529 Weathering Intensity Index
    Topography
    Aspect 296.0 degrees
    Averaged Topographic Relief 168.375 metres
    Bathymetry and Topography 9 sec 65.0 m
    Elevation 77.0 m
    Topographic Slope (degrees) 1.2165213 degrees
    Topographic relief 87.13421 m
    Topographic slope (%) 4.806296 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.212 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 27.0 %
    Fractional Cover - Bare Soil (2012-03-05) 30.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 41.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 29.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0128 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.4 m^2 plant / m^2 ground
    NDVI Mean 53.0 NDVI x 100
    NPP Mean 4.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.3885 NDVI