Occurrence record: BOLD - Australian records - 3977402

GenomicDNA of LEPIDOPTERA | Moths recorded on 1998-11-25

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3977402
Other catalog numbers recordID:1889306;ProcessID:ANICS563-11;sampleID:11ANIC-04563
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Edwards, E.D.|Sutrisno, H.
Supplied as "E.D.Edwards, H.Sutrisno"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Field number 11ANIC-04563
Occurrence status present
Abcd identification qualifier Not provided

Event

Field number 11ANIC-04563
Record date 1998-11-25
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type wellformed

Geospatial

Country Australia
State / Province Queensland
Locality Tablelands (R)
Locality The Millstream Falls 5km SW of Ravenshoe
Latitude -17.39
Longitude 145.27
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession JN271278
markercode COI-5P
nucleotides AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACTTCTTTAAGTTTATTAATTCGTGCAGAATTAGGTAATCCTGGATCATTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCATCTATTACACTTTTAATTTCAAGAAGAATTGTAGAAAATGGGGCCGGAACAGGATGAACTGTATACCCGCCTTTATCTTCTAATATCGCCCATGGTGGAAGATCAGTTGATTTAGCTATTTTTTCATTACATTTGGCAGGAATTTCCTCAATTTTAGGTGCAATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCTTTATTCGTTTGAGCAGTAGGAATTACCGCATTCTTATTATTATTATCTTTACCAGTTTTAGCGGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACATCATTCTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:44Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Tropical Savanna Australian Tropical Savanna
    Fallow practice - dominant (area) Fallow greater than 9 months
    Fallow practice - dominant (number) Fallow greater than 9 months
    GER National Corridor GER National Corridor
    GER Standard Boundary GER Standard Boundary
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Northern Australia and Trans-Fly Savannas
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    Irrigation practice - dominant 6. Local knowledge
    Land use Grazing of native pastures
    NRM Regions 2010 Northern Gulf
    NRM Regions 2014 Northern Gulf
    NRM Regions 2015 Northern Gulf
    NRM Regions 2017 Northern Gulf
    NRM Regions 2017 (Qld 2019) Northern Gulf
    Stubble practice - dominant (area) Stubble mulched
    Stubble practice - dominant (number) Stubble mulched
    Tillage practice - dominant (area) Other cultivation
    Tillage practice - dominant (number) 1-2 = other cultivations
    Area management
    National Landcare Program Management Units 2018 Northern Gulf
    Biodiversity
    Freshwater Ecoregions of the World Arafura - Carpentaria
    IBRA 6 Regions Einasleigh Uplands
    IBRA 6 Sub Regions Herberton - Wairuna
    IBRA 7 Regions Einasleigh Uplands
    IBRA 7 Subregions Herberton-Wairuna
    Terrestrial Ecoregional Boundaries Einasleigh Upland Savanna
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Strongly developed wet and dry seasons with cooler winter and with a growing season lasting at least six months
    Koppen Climate Classification (All Classes) Subtropical: distinctly dry winter
    Koppen Climate Classification (Major Classes) Subtropical
    Fire
    Fire regime niches Eucalypt savanna woodland (monsoon tropical)
    Hydrology
    Drainage Divisions Level 1 Carpentaria Coast
    Drainage Divisions Level 2 MITCHELL-COLEMAN RIVERS (QLD)
    River Regions MITCHELL-COLEMAN RIVERS (QLD)
    Marine
    Marine Ecoregions of the World Central and Southern Great Barrier Reef
    States including coastal waters Queensland (including Coastal Waters)
    Political
    ASGS Australian States and Territories Queensland
    Australian States and Territories Queensland
    Commonwealth Electoral Boundaries Kennedy
    Indigenous Land Use Agreements Bar-Barrum and Telstra ILUA
    Local Government Areas 2011 Tablelands (R)
    Local Government Areas 2012 deprecated Mareeba
    Local Government Areas PSMA 2018 MAREEBA SHIRE
    National Native Title Register (NNTR, Determinations of Native Title) - boundaries and core attributes Bar-Barrum People
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 57
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 1654
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF QLD
    PSMA ABS SA2 Statistical Areas (2016) TABLELANDS
    PSMA ABS SA3 Statistical Areas (2016) FAR NORTH
    PSMA ABS SA4 Statistical Areas (2016) QUEENSLAND - OUTBACK
    PSMA Commonwealth Electoral Boundaries (2016) KENNEDY
    PSMA Commonwealth Electoral Boundaries (2018) KENNEDY
    PSMA Indigenous Areas (2016) KURANDA - CROYDON
    PSMA Indigenous Locations (2016) ETHERIDGE TABLELANDS
    PSMA Indigenous Regions (2016) CAIRNS - ATHERTON
    PSMA Localities (2018) WATSONVILLE
    PSMA Remoteness Areas (2016) Outer Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (QLD)
    PSMA State Electoral Boundaries (2016) DALRYMPLE
    PSMA State Electoral Boundaries (2018) HILL
    PSMA States (2016) QUEENSLAND
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (QLD)
    Statistical Local Areas Tablelands (R) - Mareeba
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Cairns Region
    Surface Geology of Australia Cga9
    Topography
    Physiographic Provinces of Australia Peninsular Uplands Province
    Physiographic Regions 2011 Garnet uplands
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Other special rights, Native forest
    Forests of Australia (2013) v2.0 Eucalypt Medium Woodland
    Land cover Native shrublands and heathlands
    NVIS 4.1 Major Vegetation Groups Eucalypt Woodlands
    NVIS 4.1 Major Vegetation Subgroups Eucalyptus woodlands with a shrubby understorey
    Tenure of Australia's forests (2013) v2.0 Other Crown Land
    Vegetation - condition Modified
    Vegetation types - native Eucalypt woodlands
    Vegetation types - present Eucalyptus woodlands

    Environmental sampling for this location

    Area Management
    Beef numbers 1783696.0 dse
    Dairy numbers 4953.0 dse
    Dolomite (acidity) 1.0 t/ha
    Dolomite (physical) 1.0 t/ha
    Gypsum 0.0 t/ha
    Lime 1.0 t/ha
    Natural resource management expenditure 3003802.0 $
    Natural resource management expenditure - additional 0.0 $/ha
    Nitrogen 0.09275748 t/ha
    Sheep numbers 0.0 dse
    Area management
    Phosphorus 0.032130938 t/ha
    Potassium 0.11777751 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.9249
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 4.9561
    Endemism 0.027417194
    Endemism (Non-marine) 0.028158706
    Mammals – Fritz et al 2009 - 0.5 degree 0.5794
    Migratory species (2008) 6.0 frequency
    Occurrence Density 2139.0 frequency
    Shannon Diversity (H) 5.3562355 index
    Species Richness 492.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 16.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.50536036
    2030A1BMk35M: Aridity index - month max 1.738864
    2030A1BMk35M: Aridity index - month min 0.054169632
    2030A1BMk35M: Evaporation - annual mean 140.82957 mm
    2030A1BMk35M: Evaporation - month max 187.01 mm
    2030A1BMk35M: Evaporation - month min 93.92 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.37 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.41 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.29 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 68.6464 %
    2030A1BMk35M: Humidity - month max relative 3pm 75.204994 %
    2030A1BMk35M: Humidity - month min relative 3pm 59.4737 %
    2030A1BMk35M: Precipitation - annual mean 74.5175 mm
    2030A1BMk35M: Precipitation - driest month 8.36 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.4619978
    2030A1BMk35M: Precipitation - max difference between successive months 2.264516 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -4.04497 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 17.153395
    2030A1BMk35M: Precipitation - spring or autumn season -1.1525944
    2030A1BMk35M: Precipitation - summer or winter season 15.669761
    2030A1BMk35M: Precipitation - wettest month 235.39 mm
    2030A1BMk35M: Precipitation deficit - annual mean -66.31208 mm
    2030A1BMk35M: Precipitation deficit - month max -167.82999 mm
    2030A1BMk35M: Precipitation deficit - month min 100.020004 mm
    2030A1BMk35M: Radiation - max month precipitation modified 25.62 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 20.000834 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 15.09 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 27.079166 degrees C
    2030A1BMk35M: Temperature - annual min mean 15.791667 degrees C
    2030A1BMk35M: Temperature - annual range 20.0 degrees C
    2030A1BMk35M: Temperature - coldest month min 10.77 degrees C
    2030A1BMk35M: Temperature - coolest month max 22.64 degrees C
    2030A1BMk35M: Temperature - max difference in max 2.75 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 2.6900024 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 13.670013 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 11.287503 degrees C
    2030A1BMk35M: Temperature - min difference in max -1.8399963 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -3.2200012 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 8.959991 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 30.77 degrees C
    2030A1BMk35M: Temperature - warmest month min 20.0 degrees C
    Aridity index - annual mean 0.61005956
    Aridity index - month max 1.9301218
    Aridity index - month min 0.07733369
    Evaporation - annual mean 129.29596 (ml/5km x 5km pixel)
    Evaporation - average 18175.0 ml
    Evaporation - month max 180.70494 mm
    Evaporation - month min 82.81174 mm
    Evaporation - variability 17.0 %
    Growth index C3 macrotherm plants - annual mean 0.34 index
    Growth index C3 mesotherm plants - annual mean 0.5 index
    Growth index C4 megatherm plants - annual mean 0.25 index
    Humidity - annual mean relative 81.4753 %
    Humidity - annual mean relative 3pm 67.90471 %
    Humidity - month max relative 88.18013 %
    Humidity - month max relative 3pm 74.37045 %
    Humidity - month min relative 58.676514 %
    Humidity - month min relative 3pm 58.676514 %
    Precipitation - annual 926.0 mm
    Precipitation - annual (Bio12) 947.0 mm
    Precipitation - annual (log) seasonality index 0.4041451
    Precipitation - annual mean 81.16416 mm
    Precipitation - annual seasonality 5.9772763
    Precipitation - annual seasonality ratio 7.0265355
    Precipitation - autumn 245.0 mm
    Precipitation - autumn reliability 42.0 %
    Precipitation - coldest quarter (Bio19) 42.0 mm
    Precipitation - driest month 10.0 mm
    Precipitation - driest period (Bio14) 1.0 mm
    Precipitation - driest quarter (Bio17) 32.0 mm
    Precipitation - equinox seasonality ratio 0.44619197
    Precipitation - max difference between successive months 2.580645 mm/day
    Precipitation - min difference between successive months -4.4055777 mm/day
    Precipitation - seasonality (Bio15) 98.0 mm
    Precipitation - solstice seasonality ratio 13.370952
    Precipitation - spring 109.0 mm
    Precipitation - spring or autumn (log) season -0.17001636
    Precipitation - spring or autumn season -1.2300941
    Precipitation - spring reliability 27.0 %
    Precipitation - summer 570.0 mm
    Precipitation - summer or winter (log) season 0.6805571
    Precipitation - summer or winter season 12.088285
    Precipitation - summer reliability 52.0 %
    Precipitation - warmest quarter (Bio18) 518.0 mm
    Precipitation - wettest month 227.8131 mm
    Precipitation - wettest period (Bio13) 59.0 mm
    Precipitation - wettest quarter (Bio16) 583.0 mm
    Precipitation - winter 41.0 mm
    Precipitation - winter reliability 28.0 %
    Precipitation deficit - annual mean -48.1318 mm
    Precipitation deficit - month max -158.70494 mm
    Precipitation deficit - month min 109.78267 mm
    Radiation - annual mean (Bio20) 19.9 MJ/m2/day
    Radiation - coldest quarter (Bio27) 16.4 MJ/m2/day
    Radiation - driest quarter (Bio25) 18.0 MJ/m2/day
    Radiation - highest period (Bio21) 25.6 MJ/m2/day
    Radiation - lowest period (Bio22) 14.8 MJ/m2/day
    Radiation - max month precipitation modified 25.4 MJ/m2/day
    Radiation - mean annual precipitation modified 19.858334 MJ/m2/day
    Radiation - min month precipitation modified 15.0 MJ/m2/day
    Radiation - seasonality (Bio23) 16.0
    Radiation - warmest quarter (Bio26) 22.4 MJ/m2/day
    Radiation - wettest quarter (Bio24) 20.7 MJ/m2/day
    Temperature - annual max mean 25.324167 degrees C
    Temperature - annual mean (Bio01) 20.6 degrees C
    Temperature - annual min mean 14.276667 degrees C
    Temperature - annual range 19.200012 degrees C
    Temperature - annual range (Bio07) 20.1 degrees C
    Temperature - coldest month min 9.41 degrees C
    Temperature - coldest period min (Bio06) 9.9 degrees C
    Temperature - coldest quarter mean (Bio11) 16.4 degrees C
    Temperature - coolest month max 20.99 degrees C
    Temperature - diurnal range mean (Bio02) 11.2 degrees C
    Temperature - driest quarter mean (Bio09) 17.0 degrees C
    Temperature - isothermality (Bio03) 0.56 %
    Temperature - max absolute mean max 39.0 degrees C
    Temperature - max difference in max 2.5400085 degrees C/day
    Temperature - max difference in min 2.289978 degrees C/day
    Temperature - max month diurnal range 13.26001 degrees C
    Temperature - mean annual absolute mean min 2.7430832 degrees C
    Temperature - mean annual diurnal range 11.047503 degrees C
    Temperature - min absolute mean min -3.648 degrees C
    Temperature - min difference in max -1.8599854 degrees C/day
    Temperature - min difference in min -2.7900085 degrees C/day
    Temperature - min month diurnal range 8.910004 degrees C
    Temperature - month hottest maximum 28.96 degrees C
    Temperature - month mean absolute max 33.99175 degrees C
    Temperature - seasonality (Bio04) 1.01
    Temperature - warmest month min 18.32 degrees C
    Temperature - warmest period max (Bio05) 30.0 degrees C
    Temperature - warmest quarter (Bio10) 23.9 degrees C
    Temperature - wettest quarter mean (Bio08) 23.6 degrees C
    Vapour pressure deficit - annual mean 0.36494341 KPa
    Vapour pressure deficit - annual mean 9am 0.5155675 KPa
    Vapour pressure deficit - month max 0.8083935 KPa
    Vapour pressure deficit - month max 9am 0.8083935 KPa
    Vapour pressure deficit - month min 0.10972214 KPa
    Vapour pressure deficit - month min 9am 0.30957043 KPa
    Wind run - annual mean 137.18881 km/day
    Wind run - month max 160.13232 km/day
    Wind run - month min 118.197365 km/day
    Wind speed - annual mean 3pm 2.674006 m/s
    Wind speed - annual mean 9am 2.6632495 m/s
    Wind speed - annual mean 9am or 3pm 3.3 m/s
    Wind speed - month max 3pm 3.3 m/s
    Wind speed - month max 9am 3.3 m/s
    Wind speed - month max 9am or 3pm 3.3 m/s
    Wind speed - month min 3pm 2.2 m/s
    Wind speed - month min 9am 2.0 m/s
    Wind speed - month min 9am or 3pm 2.0 m/s
    WorldClim: Precipitation - annual 1046.0 mm
    WorldClim: Precipitation - coldest quarter 48.0 mm
    WorldClim: Precipitation - driest month 11.0 mm
    WorldClim: Precipitation - driest quarter 36.0 mm
    WorldClim: Precipitation - seasonality 93.0
    WorldClim: Precipitation - warmest quarter 587.0 mm
    WorldClim: Precipitation - wettest month 225.0 mm
    WorldClim: Precipitation - wettest quarter 646.0 mm
    WorldClim: Temperature - annual mean 205.0 degrees C * 10
    WorldClim: Temperature - annual range 194.0 degrees C * 10
    WorldClim: Temperature - coldest month min 101.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 165.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 112.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 174.0 degrees C * 10
    WorldClim: Temperature - isothermality 57.0 %
    WorldClim: Temperature - seasonality 2758.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 295.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 235.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 230.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.049999997 degrees
    Distance - to coast 0.6929646 km x 100
    Distance - to non-permanent water (weighted) 0.089999996 degrees
    Distance - to permanent water (weighted) 0.049999997 km
    Euclidean Distance to Coast (metres) 69299.81 m
    Remoteness index 6.0151834
    Hydrology
    Drainage - average 584.0 megalitres/5x5km/year
    Drainage - variability 110.0 %
    Runoff - average 2668.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Marine
    Great Barrier Reef 100m DEM 834.74 m
    Social
    Age 40.535294 years
    Age - prime group 26.098042 Count
    Disadvantaged 949.35596 points (mean=1000)
    Education - degrees 7.5803924 %
    Education - vocational training 21.786274 %
    Employment 18.345097 %
    Home ownership 63.6549 %
    Income - high 22.045103 %
    Income - low 18.188234 %
    Internet 48.666668 %
    Population - change 5.2764688 count
    Population - density SLA 2006 p/sqkm) 0.30588222 people/km^2
    Unemployment rate 3.129411 %
    Work force - older 29.070587 Count
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.525087
    2030A1BMk35M: Crop factor - month max 0.9
    2030A1BMk35M: Crop factor - month min 0.054169632
    2030A1BMk35M: Water deficit - month max 67.22038 mm
    2030A1BMk35M: Water deficit - month mean 16.106062 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -0.99170834 MPa
    2030A1BMk35M: Water potential - month max -2.8643754E-14 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 47.257828
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 4.875267
    2030A1BMk35M: Water surplus - annual mean 1.1455027 mm
    2030A1BMk35M: Water surplus - month max 9.320023 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 26.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.65 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 29.0 %
    Bouguer gravity anomalies -207.0724 Gal
    Bulk density 1.4521729 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic 0.4654173 %
    Carbon store pre-European 46.04772 kgC/ha
    Clay % 5.438084 %
    Crop factor - annual mean 0.5707635
    Crop factor - month max 0.9
    Crop factor - month min 0.07733369
    Erodibility 85.0 k factor
    Erosional surfaces - proportion 100.0 %
    Erosivity 5634.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 100.0 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 19.1 my
    Lithology - fertility 6.0 index
    Lithology - mean age 308.55 my
    Lithology - mean age (log) 2.4893255 log my
    Lithology - mean age range (log) 1.2810334 log my
    Magnetic anomalies -33.0 nT
    Moisture - average 41.0 %
    Moisture - variability 12.0 %
    Moisture Index - annual mean (Bio28) 0.58
    Moisture Index - coldest quarter mean (Bio35) 0.37
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 0.99
    Moisture Index - lowest period (Bio30) 0.06
    Moisture Index - lowest quarter mean (Bio33) 0.11
    Moisture Index - seasonality (Bio31) 62.0
    Moisture Index - warmest quarter mean (Bio34) 0.78
    Nitrogen - plant-available pre-European 3969.615 kgN/ha
    Nitrogen concentration pre-European 36.55061 mgN kg/H2O
    Nitrogen store pre-European 42.03024 kgN/ha
    Nutrient status 1.0 index
    Pedality hydrological score 0.0
    Ph - soil 5.0 ph
    Phosphorus - plant-available pre-European 7.713169 kgP/ha
    Phosphorus - plant-available total pre-European 638.548 kgP/ha
    Phosphorus pre-European 6.707576 mgP kg/H2O
    Soil depth 0.9 m
    Soil pedality 2.0
    Soils - coarse 0.0 class
    Substrate data reliability 1.0
    Topographic wetness index 6.05365
    Unreliable water retention parameters 0.0
    Water deficit - month max 58.967896 mm
    Water deficit - month mean 14.249541 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 41000.0 mm
    Water holding capacity - plant-available 151.0 mm
    Water potential - annual mean -0.9303294 MPa
    Water potential - month max -2.8643754E-14 MPa
    Water potential - month min -1.5 MPa
    Water stress index - annual mean 51.368717
    Water stress index - month max 81.0
    Water stress index - month min 6.960032
    Water surplus - annual mean 9.673542 mm
    Water surplus - month max 68.65199 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 0.58644 Weathering Intensity Index
    Topography
    Aspect 344.0 degrees
    Averaged Topographic Relief 274.16666 metres
    Bathymetry and Topography 9 sec 877.0 m
    Elevation 813.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Slope length 1000.0 m
    Topographic Slope (degrees) 5.8794236 degrees
    Topographic relief 57.22504 m
    Topographic roughness 2.202137 %
    Topographic slope (%) 4.555665 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 0.0
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3506 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 35.0 %
    Gross Primary Productivity (2012-03-13) 0.0019 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.7 m^2 plant / m^2 ground
    NDVI Mean 50.0 NDVI x 100
    NPP Mean 10.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.5056 NDVI
    Phenology peak day of year 2002 dry 63.933334 Day
    Phenology peak day of year 2012 wet 90.6 Day