Occurrence record: BOLD - Australian records - 3735063

GenomicDNA of COLEOPTERA | Beetles recorded on 2009-10-27

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3735063
Other catalogue numbers recordID:1667384;ProcessID:MSAC877-10;sampleID:PL0804
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Lang, P.J.
Supplied as "P.J.Lang"
Sex male
Life stage adult
License CC-BY-Int
Field number PL0804
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Peter J. Lang

Event

Field number PL0804
Record date 2009-10-27
Date precision Day

Taxonomy

Scientific name COLEOPTERA
Taxon rank order
Common name Beetles
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Coleoptera
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory South Australia
Local government area Kimba (DC)
Locality 10.2 km SSW Buckleboo
Latitude -33.004
Longitude 136.163
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HQ965832
markercode COI-5P
nucleotides TACCTTATATTTCATTTTTGGTGCTTGATCAGGAATAGTCGGAACAGCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGAACTTTAATTGGAAATGACCAAATTTATAATGTAATTGTAACTGCACATGCATTTATTATAATTTTCTTTATAGTAATACCTATTATAATAGGTGGCTTTGGTAATTGATTAGTTCCTTTAATATTAGGTGCTCCAGATATAGCTTTCCCTCGGATAAACAATATAAGATTCTGATTACTTCCTCCTTCATTAACCCTTTTACTTGCAAGAAGAATTGTAGAAAGAGGCGCAGGAACAGGTTGAACTGTTTATCCACCCTTAGCTGCAAACACAGCTCATAGAGGTGCTTCAGTAGATTTAGCTATTTTTAGACTTCATTTAGCTGGTATTTCTTCTATTTTAGGTGCTGTTAATTTTATTACTACAGTAATTAATATACGTACAACAGGAATAACTTTTGATCAAATACCTTTATTTGTGTGAAGAGTAGCAATTACTGCACTTTTACTTTTACTTTCTCTACCAGTTCTTGCAGGTGCAATTACTATACTTTTAACAGATCGAAATTTCAATACATCGTTTTTTGATCCAACAGGGGGAGGTGACCCTATTTTATATCAACATTTATTT
owner institution code Research Collection of Peter J. Lang
sequence last updated 2011-11-14T08:11:44Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) Fallow 3-9 months
    Fallow practice - dominant (number) Fallow 3-9 months
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Global 200 priority ecoregions - Terrestrial Southern Australia Mallee and Woodlands
    Irrigation practice - dominant No irrigation
    Land use Cropping
    NRM Regions 2010 Eyre Peninsula
    NRM Regions 2014 Eyre Peninsula
    NRM Regions 2015 Eyre Peninsula
    NRM Regions 2017 Eyre Peninsula
    NRM Regions 2017 (Qld 2019) Eyre Peninsula
    Stubble practice - dominant (area) Stubble mulched
    Stubble practice - dominant (number) Stubble mulched
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 Eyre Peninsula
    Biodiversity
    Freshwater Ecoregions of the World Paleo
    IBRA 6 Regions Eyre Yorke Block
    IBRA 6 Sub Regions Eyre Hills
    IBRA 7 Regions Eyre Yorke Block
    IBRA 7 Subregions Eyre Hills
    Terrestrial Ecoregional Boundaries Eyre And York Mallee
    World Anthropogenic Biomes (2000) Remote croplands
    Climate
    Agroclimatic classification of Australia "Mediterranean" climate, but with drier cooler winters and less growth than Classic "Mediterranean" climate
    Koppen Climate Classification (All Classes) Grassland: warm (persistently dry)
    Koppen Climate Classification (Major Classes) Grassland
    Fire
    Fire regime niches Pasture, cropland (temperate)
    Hydrology
    Drainage Divisions Level 1 South Western Plateau
    Drainage Divisions Level 2 GAIRDNER
    River Regions GAIRDNER
    Marine
    Marine Ecoregions of the World South Australian Gulfs
    States including coastal waters South Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories South Australia
    Australian States and Territories South Australia
    Commonwealth Electoral Boundaries Grey
    Local Government Areas 2011 Kimba (DC)
    Local Government Areas 2012 deprecated Kimba
    Local Government Areas PSMA 2018 THE DC OF KIMBA
    Native Title Determinations (13/7/2020) Barngarla Native Title Claim SCD2016/001
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 194
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 697
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF SA
    PSMA ABS SA2 Statistical Areas (2016) KIMBA - CLEVE - FRANKLIN HARBOUR
    PSMA ABS SA3 Statistical Areas (2016) EYRE PENINSULA AND SOUTH WEST
    PSMA ABS SA4 Statistical Areas (2016) SOUTH AUSTRALIA - OUTBACK
    PSMA Commonwealth Electoral Boundaries (2016) GREY
    PSMA Commonwealth Electoral Boundaries (2018) GREY
    PSMA Indigenous Areas (2016) CEDUNA - WEST COAST
    PSMA Indigenous Locations (2016) EYRE PENINSULA
    PSMA Indigenous Regions (2016) PORT LINCOLN - CEDUNA
    PSMA Localities (2018) PINKAWILLINIE
    PSMA Remoteness Areas (2016) Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (SA)
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) GILES
    PSMA States (2016) SOUTH AUSTRALIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (SA)
    Statistical Local Areas Kimba (DC)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Gawler Region
    Surface Geology of Australia Czs
    Topography
    Physiographic Provinces of Australia Eyre Peninsula Province
    Physiographic Regions 2011 Eyre Dunefield
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Annual crops and highly modified pastures
    NVIS 4.1 Major Vegetation Groups Mallee Woodlands and Shrublands
    NVIS 4.1 Major Vegetation Subgroups Mallee with a dense shrubby understorey
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Replaced
    Vegetation types - native Mallee woodlands and shrublands
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 3070893.0 $
    Area management
    Phosphorus 0.012876 t/ha
    Potassium 0.020203 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.7705
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 1.8778
    Endemism 0.0035928027
    Endemism (Non-marine) 0.0035976542
    Mammals – Fritz et al 2009 - 0.5 degree 0.0
    Migratory species (2008) 3.0 frequency
    Occurrence Density 306.0 frequency
    Shannon Diversity (H) 5.207377 index
    Species Richness 208.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 3.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.20162158
    2030A1BMk35M: Evaporation - month min 65.02 mm
    2030A1BMk35M: Precipitation - annual mean 23.389166 mm
    2030A1BMk35M: Precipitation - driest month 13.26 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.4285465
    2030A1BMk35M: Precipitation - spring or autumn season 0.4212147
    2030A1BMk35M: Temperature - annual max mean 25.163334 degrees C
    2030A1BMk35M: Temperature - annual min mean 11.0125 degrees C
    2030A1BMk35M: Temperature - annual range 27.399994 degrees C
    Aridity index - annual mean 0.23870009
    Aridity index - month max 0.5753117
    Aridity index - month min 0.056009654
    Evaporation - annual mean 174.68082 (ml/5km x 5km pixel)
    Evaporation - average 7583.0 ml
    Evaporation - month max 321.37317 mm
    Evaporation - month min 60.836582 mm
    Evaporation - variability 23.0 %
    Growth index C3 macrotherm plants - annual mean 0.03 index
    Growth index C3 mesotherm plants - annual mean 0.12 index
    Growth index C4 megatherm plants - annual mean 0.02 index
    Humidity - annual mean relative 75.430725 %
    Humidity - annual mean relative 3pm 58.87049 %
    Humidity - month max relative 89.89787 %
    Humidity - month max relative 3pm 73.33695 %
    Humidity - month min relative 46.640266 %
    Humidity - month min relative 3pm 46.640266 %
    Precipitation - annual 316.0 mm
    Precipitation - annual (Bio12) 315.0 mm
    Precipitation - annual mean 26.719515 mm
    Precipitation - annual seasonality -0.62304217
    Precipitation - coldest quarter (Bio19) 114.0 mm
    Precipitation - driest month 16.0 mm
    Precipitation - driest period (Bio14) 3.0 mm
    Precipitation - driest quarter (Bio17) 46.0 mm
    Precipitation - equinox seasonality ratio 1.1662027
    Precipitation - seasonality (Bio15) 37.0 mm
    Precipitation - spring or autumn season 0.16386177
    Precipitation - warmest quarter (Bio18) 49.0 mm
    Precipitation - wettest month 39.0 mm
    Precipitation - wettest period (Bio13) 10.0 mm
    Precipitation - wettest quarter (Bio16) 115.0 mm
    Radiation - annual mean (Bio20) 18.9 MJ/m2/day
    Radiation - seasonality (Bio23) 37.0
    Radiation - warmest quarter (Bio26) 26.6 MJ/m2/day
    Temperature - annual max mean 23.3675 degrees C
    Temperature - annual mean (Bio01) 17.1 degrees C
    Temperature - annual min mean 9.359167 degrees C
    Temperature - annual range 26.73822 degrees C
    Temperature - annual range (Bio07) 27.7 degrees C
    Temperature - coldest month min 4.13 degrees C
    Temperature - coldest period min (Bio06) 4.6 degrees C
    Temperature - coldest quarter mean (Bio11) 11.1 degrees C
    Temperature - diurnal range mean (Bio02) 14.0 degrees C
    Temperature - driest quarter mean (Bio09) 21.4 degrees C
    Temperature - isothermality (Bio03) 0.5 %
    Temperature - month hottest maximum 31.29 degrees C
    Temperature - seasonality (Bio04) 1.64
    Temperature - warmest month min 15.07 degrees C
    Temperature - warmest period max (Bio05) 32.4 degrees C
    Temperature - warmest quarter (Bio10) 23.2 degrees C
    Temperature - wettest quarter mean (Bio08) 11.2 degrees C
    Wind run - annual mean 187.69028 km/day
    WorldClim: Precipitation - annual 325.0 mm
    WorldClim: Precipitation - coldest quarter 117.0 mm
    WorldClim: Precipitation - driest month 13.0 mm
    WorldClim: Precipitation - driest quarter 45.0 mm
    WorldClim: Precipitation - seasonality 35.0
    WorldClim: Precipitation - warmest quarter 45.0 mm
    WorldClim: Precipitation - wettest month 40.0 mm
    WorldClim: Precipitation - wettest quarter 117.0 mm
    WorldClim: Temperature - annual mean 167.0 degrees C * 10
    WorldClim: Temperature - annual range 268.0 degrees C * 10
    WorldClim: Temperature - coldest month min 47.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 107.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 137.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 226.0 degrees C * 10
    WorldClim: Temperature - isothermality 51.0 %
    WorldClim: Temperature - seasonality 4651.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 315.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 226.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 107.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.60671246 degrees
    Distance - to coast 0.9884331 km x 100
    Distance - to non-permanent water (weighted) 0.60671246 degrees
    Distance - to permanent water (weighted) 1.2532358 km
    Euclidean Distance to Coast (metres) 65329.17 m
    Remoteness index 10.361168
    Hydrology
    Drainage - average 19.0 megalitres/5x5km/year
    Drainage - variability 169.0 %
    Runoff - average 2.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 0.3 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 51.851734
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 103.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.41 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 29.0 %
    Bulk density 1.5304651 Mg/m^3
    Carbon - organic 0.62708247 %
    Clay % 36.88372 %
    Hydrologic conductivity - average saturated 48.57143 mm/h
    Moisture Index - annual mean (Bio28) 0.23
    Moisture Index - highest quarter mean (Bio32) 0.5
    Nutrient status 1.4 index
    Ph - soil 6.0 ph
    Soil depth 0.8 m
    Soil pedality 2.7209303
    Water holding capacity 24000.0 mm
    Water stress index - month max 51.778053
    Weathering Intensity V2 4.90102 Weathering Intensity Index
    Topography
    Aspect 265.0 degrees
    Averaged Topographic Relief 76.833336 metres
    Bathymetry and Elvation 9 sec 212.0 m
    Elevation 219.0 m
    Topographic Slope (degrees) 1.1267611 degrees
    Topographic relief 14.2962 m
    Topographic slope (%) 0.9141694 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.1132 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 15.0 %
    Fractional Cover - Bare Soil (2012-03-05) 29.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 57.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 14.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0052 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.3 m^2 plant / m^2 ground
    NDVI Mean 29.0 NDVI x 100
    NPP Mean 2.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.2166 NDVI